FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627087_at:

>probe:Drosophila_2:1627087_at:201:265; Interrogation_Position=1138; Antisense; CAGATGTTCGCCGACAGTCTAAAGC
>probe:Drosophila_2:1627087_at:58:173; Interrogation_Position=1158; Antisense; AAAGCGAATGATTAGTCCGTGGGAT
>probe:Drosophila_2:1627087_at:680:421; Interrogation_Position=1183; Antisense; GAGAATGACTGTATCGAGCTCTTCG
>probe:Drosophila_2:1627087_at:521:553; Interrogation_Position=1239; Antisense; GGAGCTGGACTACACCCAAAGTCAT
>probe:Drosophila_2:1627087_at:381:149; Interrogation_Position=1293; Antisense; ACTTATAGCGTCCATGAGTTCGGGA
>probe:Drosophila_2:1627087_at:143:575; Interrogation_Position=1344; Antisense; GGCGGAAACCAAAGCTACAGATGTC
>probe:Drosophila_2:1627087_at:22:381; Interrogation_Position=1393; Antisense; GAACCTGAATCCGAGCCAATGGAAA
>probe:Drosophila_2:1627087_at:592:391; Interrogation_Position=1414; Antisense; GAAACCGCCTCCAAGGAAGCTGAGT
>probe:Drosophila_2:1627087_at:336:485; Interrogation_Position=1449; Antisense; GTATGCAGAATATCAGCCAGACTCA
>probe:Drosophila_2:1627087_at:252:405; Interrogation_Position=1468; Antisense; GACTCAGCACAGACAAGCGACGAAA
>probe:Drosophila_2:1627087_at:87:351; Interrogation_Position=1533; Antisense; GCAGTCAATGCGCTTGTTCCAGATA
>probe:Drosophila_2:1627087_at:629:13; Interrogation_Position=1570; Antisense; ATTACTAGCGATACCAATGGCCAGG
>probe:Drosophila_2:1627087_at:235:401; Interrogation_Position=1635; Antisense; GACATAGTGAACCTTAAGCTTGCTT
>probe:Drosophila_2:1627087_at:233:343; Interrogation_Position=1652; Antisense; GCTTGCTTTCAATTACGTTTACTTA

Paste this into a BLAST search page for me
CAGATGTTCGCCGACAGTCTAAAGCAAAGCGAATGATTAGTCCGTGGGATGAGAATGACTGTATCGAGCTCTTCGGGAGCTGGACTACACCCAAAGTCATACTTATAGCGTCCATGAGTTCGGGAGGCGGAAACCAAAGCTACAGATGTCGAACCTGAATCCGAGCCAATGGAAAGAAACCGCCTCCAAGGAAGCTGAGTGTATGCAGAATATCAGCCAGACTCAGACTCAGCACAGACAAGCGACGAAAGCAGTCAATGCGCTTGTTCCAGATAATTACTAGCGATACCAATGGCCAGGGACATAGTGAACCTTAAGCTTGCTTGCTTGCTTTCAATTACGTTTACTTA

Full Affymetrix probeset data:

Annotations for 1627087_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720