FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627088_at:

>probe:Drosophila_2:1627088_at:3:499; Interrogation_Position=104; Antisense; GTCTGAGGAGGACAACTCGTCCCAA
>probe:Drosophila_2:1627088_at:348:143; Interrogation_Position=118; Antisense; ACTCGTCCCAAGGTCCAAGTCTAAG
>probe:Drosophila_2:1627088_at:12:653; Interrogation_Position=163; Antisense; TCAACTGGCCCTGTGATGTGGGTCA
>probe:Drosophila_2:1627088_at:96:531; Interrogation_Position=182; Antisense; GGGTCACTTCCCAGAGGCATTCATT
>probe:Drosophila_2:1627088_at:404:423; Interrogation_Position=270; Antisense; GAGAACTACGCCGTCAATCAGTTGA
>probe:Drosophila_2:1627088_at:609:567; Interrogation_Position=295; Antisense; GGCAGTGCATCTTGGATGGCCAGAT
>probe:Drosophila_2:1627088_at:544:579; Interrogation_Position=312; Antisense; GGCCAGATGGACGTGCACTGCGTTA
>probe:Drosophila_2:1627088_at:429:705; Interrogation_Position=334; Antisense; TTAGGCGTTCGATTGGATACACCAT
>probe:Drosophila_2:1627088_at:5:457; Interrogation_Position=349; Antisense; GATACACCATGTCATTCATTCACCA
>probe:Drosophila_2:1627088_at:236:13; Interrogation_Position=366; Antisense; ATTCACCACCAAATGAGCCAGGCGA
>probe:Drosophila_2:1627088_at:197:493; Interrogation_Position=398; Antisense; GTAAGCTCACGACTTGGTGATCAGT
>probe:Drosophila_2:1627088_at:306:657; Interrogation_Position=433; Antisense; TAAGGACATTCCTTTAGCCACCTTT
>probe:Drosophila_2:1627088_at:536:193; Interrogation_Position=44; Antisense; AACTCTGGTGATTCTACTTCTTTCG
>probe:Drosophila_2:1627088_at:219:149; Interrogation_Position=59; Antisense; ACTTCTTTCGGCTCTGGCTTTGGTG

Paste this into a BLAST search page for me
GTCTGAGGAGGACAACTCGTCCCAAACTCGTCCCAAGGTCCAAGTCTAAGTCAACTGGCCCTGTGATGTGGGTCAGGGTCACTTCCCAGAGGCATTCATTGAGAACTACGCCGTCAATCAGTTGAGGCAGTGCATCTTGGATGGCCAGATGGCCAGATGGACGTGCACTGCGTTATTAGGCGTTCGATTGGATACACCATGATACACCATGTCATTCATTCACCAATTCACCACCAAATGAGCCAGGCGAGTAAGCTCACGACTTGGTGATCAGTTAAGGACATTCCTTTAGCCACCTTTAACTCTGGTGATTCTACTTCTTTCGACTTCTTTCGGCTCTGGCTTTGGTG

Full Affymetrix probeset data:

Annotations for 1627088_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720