FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627090_at:

>probe:Drosophila_2:1627090_at:682:231; Interrogation_Position=372; Antisense; AATGACATCTGTGTCCAGCTGGGTC
>probe:Drosophila_2:1627090_at:250:591; Interrogation_Position=391; Antisense; TGGGTCTCAACGAAGTTGCCCGCAA
>probe:Drosophila_2:1627090_at:293:55; Interrogation_Position=429; Antisense; ATGACTCTCTTCAAGGGCGTAGCGG
>probe:Drosophila_2:1627090_at:41:75; Interrogation_Position=460; Antisense; AGGACATGGGTACCGACACCAGCCA
>probe:Drosophila_2:1627090_at:685:577; Interrogation_Position=515; Antisense; GGCCTGCCGCCTGCTCAAAAAGAAG
>probe:Drosophila_2:1627090_at:611:479; Interrogation_Position=540; Antisense; GTTTCGAAATCAAAGCTCATGCCCT
>probe:Drosophila_2:1627090_at:521:337; Interrogation_Position=554; Antisense; GCTCATGCCCTTCAGTAATTTGCGA
>probe:Drosophila_2:1627090_at:413:655; Interrogation_Position=569; Antisense; TAATTTGCGACCCTCCCAGTTTCAA
>probe:Drosophila_2:1627090_at:124:309; Interrogation_Position=584; Antisense; CCAGTTTCAACTGCTCGAGCAGCAG
>probe:Drosophila_2:1627090_at:77:563; Interrogation_Position=611; Antisense; GGAACGCATGATAGCTAAGCACCAC
>probe:Drosophila_2:1627090_at:514:421; Interrogation_Position=641; Antisense; GAGCAAAGTACCATCTAGCACCGAT
>probe:Drosophila_2:1627090_at:78:365; Interrogation_Position=801; Antisense; GAATTAGAAGCATCCCAATCGCATA
>probe:Drosophila_2:1627090_at:687:43; Interrogation_Position=818; Antisense; ATCGCATATGGATAGCCAGCTTCTC
>probe:Drosophila_2:1627090_at:89:343; Interrogation_Position=836; Antisense; GCTTCTCGAGGCTTAGGCATTTATA

Paste this into a BLAST search page for me
AATGACATCTGTGTCCAGCTGGGTCTGGGTCTCAACGAAGTTGCCCGCAAATGACTCTCTTCAAGGGCGTAGCGGAGGACATGGGTACCGACACCAGCCAGGCCTGCCGCCTGCTCAAAAAGAAGGTTTCGAAATCAAAGCTCATGCCCTGCTCATGCCCTTCAGTAATTTGCGATAATTTGCGACCCTCCCAGTTTCAACCAGTTTCAACTGCTCGAGCAGCAGGGAACGCATGATAGCTAAGCACCACGAGCAAAGTACCATCTAGCACCGATGAATTAGAAGCATCCCAATCGCATAATCGCATATGGATAGCCAGCTTCTCGCTTCTCGAGGCTTAGGCATTTATA

Full Affymetrix probeset data:

Annotations for 1627090_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720