FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627091_at:

>probe:Drosophila_2:1627091_at:299:509; Interrogation_Position=310; Antisense; GTGAATCAGGCCGTCGATTGCTCCA
>probe:Drosophila_2:1627091_at:241:465; Interrogation_Position=325; Antisense; GATTGCTCCAGTTATGGCTGCATTC
>probe:Drosophila_2:1627091_at:495:63; Interrogation_Position=368; Antisense; ATGTGACCAGAACTTATGTGCCCAG
>probe:Drosophila_2:1627091_at:517:623; Interrogation_Position=386; Antisense; TGCCCAGTCATTACACTAACTTTCG
>probe:Drosophila_2:1627091_at:145:369; Interrogation_Position=414; Antisense; GAATGACATAGCTCTGCTCAGACTA
>probe:Drosophila_2:1627091_at:570:423; Interrogation_Position=491; Antisense; GAGACTACACCTGGTCGTCGAACAT
>probe:Drosophila_2:1627091_at:596:599; Interrogation_Position=528; Antisense; TGTCAAGTTCAATACCACCGGATGG
>probe:Drosophila_2:1627091_at:180:411; Interrogation_Position=554; Antisense; GACGCACTGAATCCCGCATAAACAG
>probe:Drosophila_2:1627091_at:179:341; Interrogation_Position=620; Antisense; GCTACTGTGCCCAAGTCTTTGGCAA
>probe:Drosophila_2:1627091_at:284:183; Interrogation_Position=655; Antisense; AAAAGCCACATCTGCGTAGCTAGCA
>probe:Drosophila_2:1627091_at:219:675; Interrogation_Position=671; Antisense; TAGCTAGCAGCACTGGTTCCACTTG
>probe:Drosophila_2:1627091_at:477:535; Interrogation_Position=771; Antisense; GGTCAGCTATGGTGCGGTTCACTGC
>probe:Drosophila_2:1627091_at:345:727; Interrogation_Position=797; Antisense; TTGGCCCTACTGTCTACACAAACGT
>probe:Drosophila_2:1627091_at:17:199; Interrogation_Position=817; Antisense; AACGTCATTCACTTTGCGAACTGGA

Paste this into a BLAST search page for me
GTGAATCAGGCCGTCGATTGCTCCAGATTGCTCCAGTTATGGCTGCATTCATGTGACCAGAACTTATGTGCCCAGTGCCCAGTCATTACACTAACTTTCGGAATGACATAGCTCTGCTCAGACTAGAGACTACACCTGGTCGTCGAACATTGTCAAGTTCAATACCACCGGATGGGACGCACTGAATCCCGCATAAACAGGCTACTGTGCCCAAGTCTTTGGCAAAAAAGCCACATCTGCGTAGCTAGCATAGCTAGCAGCACTGGTTCCACTTGGGTCAGCTATGGTGCGGTTCACTGCTTGGCCCTACTGTCTACACAAACGTAACGTCATTCACTTTGCGAACTGGA

Full Affymetrix probeset data:

Annotations for 1627091_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720