FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627093_at:

>probe:Drosophila_2:1627093_at:220:623; Interrogation_Position=291; Antisense; TGCGGTTGTTTCCACTGCCAGAGGA
>probe:Drosophila_2:1627093_at:574:435; Interrogation_Position=335; Antisense; GAGGACATAAGGCTATCCGTGTATT
>probe:Drosophila_2:1627093_at:124:483; Interrogation_Position=355; Antisense; GTATTTTTGGATCACCACGGTGGTT
>probe:Drosophila_2:1627093_at:82:533; Interrogation_Position=373; Antisense; GGTGGTTAGGAAATCGCGTTGCTCT
>probe:Drosophila_2:1627093_at:75:723; Interrogation_Position=391; Antisense; TTGCTCTAAAACTCGCTAATCCTGG
>probe:Drosophila_2:1627093_at:385:339; Interrogation_Position=405; Antisense; GCTAATCCTGGCCACTGCAAAAATT
>probe:Drosophila_2:1627093_at:672:117; Interrogation_Position=482; Antisense; AGCTCTCATATGCTGGGATACCCAA
>probe:Drosophila_2:1627093_at:458:527; Interrogation_Position=511; Antisense; GGGATATCCTACACTGGGTAACCTA
>probe:Drosophila_2:1627093_at:484:685; Interrogation_Position=534; Antisense; TATACTTTGGTACCCTATACCTTGG
>probe:Drosophila_2:1627093_at:171:93; Interrogation_Position=582; Antisense; AGTTGGATACCCTTCACTTGGATGC
>probe:Drosophila_2:1627093_at:110:547; Interrogation_Position=601; Antisense; GGATGCCCTACACTTGGATACCATA
>probe:Drosophila_2:1627093_at:689:695; Interrogation_Position=748; Antisense; TTCTAGGATTAACTTGGATACCCCA
>probe:Drosophila_2:1627093_at:126:545; Interrogation_Position=763; Antisense; GGATACCCCATATTTGACTGTTATT
>probe:Drosophila_2:1627093_at:488:407; Interrogation_Position=790; Antisense; GACGGCTGTTCCCAAACTCAAGAAT

Paste this into a BLAST search page for me
TGCGGTTGTTTCCACTGCCAGAGGAGAGGACATAAGGCTATCCGTGTATTGTATTTTTGGATCACCACGGTGGTTGGTGGTTAGGAAATCGCGTTGCTCTTTGCTCTAAAACTCGCTAATCCTGGGCTAATCCTGGCCACTGCAAAAATTAGCTCTCATATGCTGGGATACCCAAGGGATATCCTACACTGGGTAACCTATATACTTTGGTACCCTATACCTTGGAGTTGGATACCCTTCACTTGGATGCGGATGCCCTACACTTGGATACCATATTCTAGGATTAACTTGGATACCCCAGGATACCCCATATTTGACTGTTATTGACGGCTGTTCCCAAACTCAAGAAT

Full Affymetrix probeset data:

Annotations for 1627093_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720