FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627097_at:

>probe:Drosophila_2:1627097_at:719:405; Interrogation_Position=135; Antisense; GACTGTTTCGAAATTACTGGCTACC
>probe:Drosophila_2:1627097_at:561:139; Interrogation_Position=150; Antisense; ACTGGCTACCAATCTACCCGATTTG
>probe:Drosophila_2:1627097_at:287:67; Interrogation_Position=230; Antisense; ATGGCAGAATACTGGTGGCGCTAAG
>probe:Drosophila_2:1627097_at:116:453; Interrogation_Position=261; Antisense; GATCTACGATGTATCCAGTGATTTC
>probe:Drosophila_2:1627097_at:52:355; Interrogation_Position=305; Antisense; GCACCCTATCTCATGTAGCTGGCAG
>probe:Drosophila_2:1627097_at:540:227; Interrogation_Position=357; Antisense; AATGGACACGCACAATTCGGAGATC
>probe:Drosophila_2:1627097_at:286:449; Interrogation_Position=391; Antisense; GATCGTTGGGAATCCATACTGGAAA
>probe:Drosophila_2:1627097_at:121:13; Interrogation_Position=422; Antisense; ATTCATGTGTCGGTGAAGTCATCGA
>probe:Drosophila_2:1627097_at:480:419; Interrogation_Position=448; Antisense; GAGCAGGGCAATCCTCTTATGGGAA
>probe:Drosophila_2:1627097_at:307:701; Interrogation_Position=563; Antisense; TTTTAACTGCCGAAACATTGCCATC
>probe:Drosophila_2:1627097_at:178:9; Interrogation_Position=579; Antisense; ATTGCCATCGGAAACCAAATCACAG
>probe:Drosophila_2:1627097_at:514:247; Interrogation_Position=622; Antisense; AATTCCAAAATTCTTATCCATGCGC
>probe:Drosophila_2:1627097_at:143:49; Interrogation_Position=637; Antisense; ATCCATGCGCAAATTTCCGATTGTT
>probe:Drosophila_2:1627097_at:703:273; Interrogation_Position=67; Antisense; CTTGCGTCCGTCTTGGTATATTTGT

Paste this into a BLAST search page for me
GACTGTTTCGAAATTACTGGCTACCACTGGCTACCAATCTACCCGATTTGATGGCAGAATACTGGTGGCGCTAAGGATCTACGATGTATCCAGTGATTTCGCACCCTATCTCATGTAGCTGGCAGAATGGACACGCACAATTCGGAGATCGATCGTTGGGAATCCATACTGGAAAATTCATGTGTCGGTGAAGTCATCGAGAGCAGGGCAATCCTCTTATGGGAATTTTAACTGCCGAAACATTGCCATCATTGCCATCGGAAACCAAATCACAGAATTCCAAAATTCTTATCCATGCGCATCCATGCGCAAATTTCCGATTGTTCTTGCGTCCGTCTTGGTATATTTGT

Full Affymetrix probeset data:

Annotations for 1627097_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720