FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627099_at:

>probe:Drosophila_2:1627099_at:289:365; Interrogation_Position=111; Antisense; GAATTTGCCATACCAGAGGCTCAGT
>probe:Drosophila_2:1627099_at:10:339; Interrogation_Position=129; Antisense; GCTCAGTACTGGGACGTTTCGAAGA
>probe:Drosophila_2:1627099_at:316:11; Interrogation_Position=177; Antisense; ATTCGTAAATTCGTGCCCGAGGCGG
>probe:Drosophila_2:1627099_at:70:413; Interrogation_Position=204; Antisense; GACCTGGCCACCATAAGTCGTGCAG
>probe:Drosophila_2:1627099_at:687:165; Interrogation_Position=266; Antisense; AAAGTACCGGGATCACTATCGTGAC
>probe:Drosophila_2:1627099_at:257:13; Interrogation_Position=317; Antisense; ATTCTTCCACCTGCACAAGGGCAAG
>probe:Drosophila_2:1627099_at:359:207; Interrogation_Position=351; Antisense; AAGCTGGACCAGAGCGTCATCAAGA
>probe:Drosophila_2:1627099_at:124:445; Interrogation_Position=374; Antisense; GATGACGCAGGCGATTGCCGCAACT
>probe:Drosophila_2:1627099_at:238:595; Interrogation_Position=398; Antisense; TGTGGACCGGCAGCCCATAGTTTTT
>probe:Drosophila_2:1627099_at:176:699; Interrogation_Position=418; Antisense; TTTTTCCCCTGATTCCGAACAAGAG
>probe:Drosophila_2:1627099_at:712:347; Interrogation_Position=442; Antisense; GCATGTTTTTGGGTGGTAGCATTCC
>probe:Drosophila_2:1627099_at:474:533; Interrogation_Position=472; Antisense; GGTCACAAACATCCCAAGTTGGCGT
>probe:Drosophila_2:1627099_at:383:727; Interrogation_Position=490; Antisense; TTGGCGTCACTAGCTATCTCAGATG
>probe:Drosophila_2:1627099_at:219:21; Interrogation_Position=535; Antisense; ATAGCTAATGTATCCGCGGTAGTGT

Paste this into a BLAST search page for me
GAATTTGCCATACCAGAGGCTCAGTGCTCAGTACTGGGACGTTTCGAAGAATTCGTAAATTCGTGCCCGAGGCGGGACCTGGCCACCATAAGTCGTGCAGAAAGTACCGGGATCACTATCGTGACATTCTTCCACCTGCACAAGGGCAAGAAGCTGGACCAGAGCGTCATCAAGAGATGACGCAGGCGATTGCCGCAACTTGTGGACCGGCAGCCCATAGTTTTTTTTTTCCCCTGATTCCGAACAAGAGGCATGTTTTTGGGTGGTAGCATTCCGGTCACAAACATCCCAAGTTGGCGTTTGGCGTCACTAGCTATCTCAGATGATAGCTAATGTATCCGCGGTAGTGT

Full Affymetrix probeset data:

Annotations for 1627099_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720