FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627101_at:

>probe:Drosophila_2:1627101_at:351:163; Interrogation_Position=1888; Antisense; AAATTCAAAGACGACAGCCCCACGA
>probe:Drosophila_2:1627101_at:525:309; Interrogation_Position=1907; Antisense; CCACGAATCAATCCCCAGAATCATA
>probe:Drosophila_2:1627101_at:340:635; Interrogation_Position=1956; Antisense; TCGCCGGTCGACAACTCATGAATAT
>probe:Drosophila_2:1627101_at:616:61; Interrogation_Position=1979; Antisense; ATGTGATACTGTTTAAGATGCTAAG
>probe:Drosophila_2:1627101_at:718:91; Interrogation_Position=2004; Antisense; AGTTTTTTGCCGGATGCACCAAAGT
>probe:Drosophila_2:1627101_at:441:545; Interrogation_Position=2015; Antisense; GGATGCACCAAAGTCCGGCAAAAGA
>probe:Drosophila_2:1627101_at:673:445; Interrogation_Position=2027; Antisense; GTCCGGCAAAAGACGTTGATAAAAT
>probe:Drosophila_2:1627101_at:191:355; Interrogation_Position=2103; Antisense; GCAAACACCCCATACACAACAAAAA
>probe:Drosophila_2:1627101_at:565:705; Interrogation_Position=2238; Antisense; TTAAAACTGAGAGAGATGAGGGCCT
>probe:Drosophila_2:1627101_at:37:445; Interrogation_Position=2252; Antisense; GATGAGGGCCTCGAACTGTGAAAGA
>probe:Drosophila_2:1627101_at:531:79; Interrogation_Position=2276; Antisense; AGGTAGATGATCACACGCTCCAATT
>probe:Drosophila_2:1627101_at:155:453; Interrogation_Position=2284; Antisense; GATCACACGCTCCAATTTTAGTTAG
>probe:Drosophila_2:1627101_at:374:17; Interrogation_Position=2298; Antisense; ATTTTAGTTAGACGCAGCTTGCTGC
>probe:Drosophila_2:1627101_at:45:229; Interrogation_Position=2405; Antisense; AATGTATAGCGCGTACTACACAAAA

Paste this into a BLAST search page for me
AAATTCAAAGACGACAGCCCCACGACCACGAATCAATCCCCAGAATCATATCGCCGGTCGACAACTCATGAATATATGTGATACTGTTTAAGATGCTAAGAGTTTTTTGCCGGATGCACCAAAGTGGATGCACCAAAGTCCGGCAAAAGAGTCCGGCAAAAGACGTTGATAAAATGCAAACACCCCATACACAACAAAAATTAAAACTGAGAGAGATGAGGGCCTGATGAGGGCCTCGAACTGTGAAAGAAGGTAGATGATCACACGCTCCAATTGATCACACGCTCCAATTTTAGTTAGATTTTAGTTAGACGCAGCTTGCTGCAATGTATAGCGCGTACTACACAAAA

Full Affymetrix probeset data:

Annotations for 1627101_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720