FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627102_at:

>probe:Drosophila_2:1627102_at:235:511; Interrogation_Position=1065; Antisense; GTGAAATCACCCGACAATTTGTATT
>probe:Drosophila_2:1627102_at:520:659; Interrogation_Position=1113; Antisense; TAAGCGATTCGTTCCAGTCAGTAGC
>probe:Drosophila_2:1627102_at:21:471; Interrogation_Position=1123; Antisense; GTTCCAGTCAGTAGCTGTTGCATAT
>probe:Drosophila_2:1627102_at:62:627; Interrogation_Position=1154; Antisense; TGCCTTTAGTTAGCGTAGTTTACAC
>probe:Drosophila_2:1627102_at:529:167; Interrogation_Position=1208; Antisense; AAATGCAGGCCGATATACTATGAAT
>probe:Drosophila_2:1627102_at:412:369; Interrogation_Position=1229; Antisense; GAATGAGTGTCTATTTCCAGGATTT
>probe:Drosophila_2:1627102_at:169:309; Interrogation_Position=1245; Antisense; CCAGGATTTATCTCACTGTGCACGT
>probe:Drosophila_2:1627102_at:99:141; Interrogation_Position=1259; Antisense; ACTGTGCACGTTTTGGGTTTGACTA
>probe:Drosophila_2:1627102_at:200:539; Interrogation_Position=1274; Antisense; GGTTTGACTAACCACCTTGTCCCAG
>probe:Drosophila_2:1627102_at:256:727; Interrogation_Position=1290; Antisense; TTGTCCCAGCAACTCTCTCAATGTA
>probe:Drosophila_2:1627102_at:456:551; Interrogation_Position=1353; Antisense; GGAGACCTGCATGAAATATATACGA
>probe:Drosophila_2:1627102_at:407:51; Interrogation_Position=839; Antisense; ATGCGATCCGGGATCAATCTTCCAG
>probe:Drosophila_2:1627102_at:168:239; Interrogation_Position=854; Antisense; AATCTTCCAGCGACAGTTCTATCAA
>probe:Drosophila_2:1627102_at:630:63; Interrogation_Position=959; Antisense; ATGGGCATTAGGCAACCAAATAGGC

Paste this into a BLAST search page for me
GTGAAATCACCCGACAATTTGTATTTAAGCGATTCGTTCCAGTCAGTAGCGTTCCAGTCAGTAGCTGTTGCATATTGCCTTTAGTTAGCGTAGTTTACACAAATGCAGGCCGATATACTATGAATGAATGAGTGTCTATTTCCAGGATTTCCAGGATTTATCTCACTGTGCACGTACTGTGCACGTTTTGGGTTTGACTAGGTTTGACTAACCACCTTGTCCCAGTTGTCCCAGCAACTCTCTCAATGTAGGAGACCTGCATGAAATATATACGAATGCGATCCGGGATCAATCTTCCAGAATCTTCCAGCGACAGTTCTATCAAATGGGCATTAGGCAACCAAATAGGC

Full Affymetrix probeset data:

Annotations for 1627102_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720