Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627104_at:

>probe:Drosophila_2:1627104_at:193:459; Interrogation_Position=2343; Antisense; GATATCCAAACAGTTCGAGCTCGAG
>probe:Drosophila_2:1627104_at:71:423; Interrogation_Position=2374; Antisense; GAGAAACCCGAGTTACATCCTCTGA
>probe:Drosophila_2:1627104_at:606:43; Interrogation_Position=2390; Antisense; ATCCTCTGATGCAGGCTTTGCAGGT
>probe:Drosophila_2:1627104_at:47:109; Interrogation_Position=2417; Antisense; AGAATCCCGAAGACTTCCTGGTCAG
>probe:Drosophila_2:1627104_at:196:445; Interrogation_Position=2448; Antisense; GATGAGGATACGTGCGTCCGATCTG
>probe:Drosophila_2:1627104_at:380:39; Interrogation_Position=2468; Antisense; ATCTGGAGGAGGCACTTCTTCTACT
>probe:Drosophila_2:1627104_at:704:53; Interrogation_Position=2605; Antisense; ATGAAGCCCATTTCGGCGGCTAAGA
>probe:Drosophila_2:1627104_at:304:659; Interrogation_Position=2625; Antisense; TAAGAACATGAAGCCGCTGCTCGTC
>probe:Drosophila_2:1627104_at:676:207; Interrogation_Position=2650; Antisense; AAGCTGCTCTCGATGCTCAAGCGGG
>probe:Drosophila_2:1627104_at:548:495; Interrogation_Position=2681; Antisense; GTCAGCTGCGCGATGTCTTAGGATG
>probe:Drosophila_2:1627104_at:438:679; Interrogation_Position=2699; Antisense; TAGGATGGAACCTGCACGGTCTGGC
>probe:Drosophila_2:1627104_at:465:641; Interrogation_Position=2718; Antisense; TCTGGCCCTGCTGCAAACGGAAGTG
>probe:Drosophila_2:1627104_at:196:65; Interrogation_Position=2753; Antisense; ATGGTGTCCAGCTCTTCAGGGAGGC
>probe:Drosophila_2:1627104_at:109:607; Interrogation_Position=2851; Antisense; TGAGACGCAATACCCTAGACTTAGT

Paste this into a BLAST search page for me
GATATCCAAACAGTTCGAGCTCGAGGAGAAACCCGAGTTACATCCTCTGAATCCTCTGATGCAGGCTTTGCAGGTAGAATCCCGAAGACTTCCTGGTCAGGATGAGGATACGTGCGTCCGATCTGATCTGGAGGAGGCACTTCTTCTACTATGAAGCCCATTTCGGCGGCTAAGATAAGAACATGAAGCCGCTGCTCGTCAAGCTGCTCTCGATGCTCAAGCGGGGTCAGCTGCGCGATGTCTTAGGATGTAGGATGGAACCTGCACGGTCTGGCTCTGGCCCTGCTGCAAACGGAAGTGATGGTGTCCAGCTCTTCAGGGAGGCTGAGACGCAATACCCTAGACTTAGT

Full Affymetrix probeset data:

Annotations for 1627104_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime