FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627105_at:

>probe:Drosophila_2:1627105_at:316:51; Interrogation_Position=1009; Antisense; ATGGAAATATGTACAATCGACCGAC
>probe:Drosophila_2:1627105_at:190:553; Interrogation_Position=521; Antisense; GGAGCACTAGGCAAAAGTACCATTA
>probe:Drosophila_2:1627105_at:41:487; Interrogation_Position=537; Antisense; GTACCATTACACTCCGAACATAACG
>probe:Drosophila_2:1627105_at:100:61; Interrogation_Position=569; Antisense; ATGTATCTCATCATTCAACAGACGT
>probe:Drosophila_2:1627105_at:571:655; Interrogation_Position=693; Antisense; TAATACACACACTTATCCCAGATTT
>probe:Drosophila_2:1627105_at:21:685; Interrogation_Position=706; Antisense; TATCCCAGATTTATTATGCACACTC
>probe:Drosophila_2:1627105_at:520:241; Interrogation_Position=733; Antisense; AATACTCATCATTTGTGGTGCCTAA
>probe:Drosophila_2:1627105_at:387:493; Interrogation_Position=781; Antisense; GTAAGCCTGATGATGTTGTTACGGC
>probe:Drosophila_2:1627105_at:709:555; Interrogation_Position=812; Antisense; GGACTACGTCGCTGAACGATTCTAC
>probe:Drosophila_2:1627105_at:710:107; Interrogation_Position=841; Antisense; AGCAAACATTTTGGGAATCCGAGGA
>probe:Drosophila_2:1627105_at:246:435; Interrogation_Position=861; Antisense; GAGGACTTGTGGGACTTACTCAACA
>probe:Drosophila_2:1627105_at:615:633; Interrogation_Position=891; Antisense; TCCCGCACACCAAACTGATGTTGAT
>probe:Drosophila_2:1627105_at:66:443; Interrogation_Position=907; Antisense; GATGTTGATTTTGCAGCGAGCTTGA
>probe:Drosophila_2:1627105_at:104:327; Interrogation_Position=922; Antisense; GCGAGCTTGATACACCATGCAGACT

Paste this into a BLAST search page for me
ATGGAAATATGTACAATCGACCGACGGAGCACTAGGCAAAAGTACCATTAGTACCATTACACTCCGAACATAACGATGTATCTCATCATTCAACAGACGTTAATACACACACTTATCCCAGATTTTATCCCAGATTTATTATGCACACTCAATACTCATCATTTGTGGTGCCTAAGTAAGCCTGATGATGTTGTTACGGCGGACTACGTCGCTGAACGATTCTACAGCAAACATTTTGGGAATCCGAGGAGAGGACTTGTGGGACTTACTCAACATCCCGCACACCAAACTGATGTTGATGATGTTGATTTTGCAGCGAGCTTGAGCGAGCTTGATACACCATGCAGACT

Full Affymetrix probeset data:

Annotations for 1627105_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720