FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627107_at:

>probe:Drosophila_2:1627107_at:103:577; Interrogation_Position=171; Antisense; GGCGAATGTTCATGCCCGAATCGAA
>probe:Drosophila_2:1627107_at:261:371; Interrogation_Position=193; Antisense; GAAGGCCAGCGATCTCCACCAGATA
>probe:Drosophila_2:1627107_at:376:673; Interrogation_Position=20; Antisense; TACCATGTGGTCTTCAGTGTTTCCT
>probe:Drosophila_2:1627107_at:488:129; Interrogation_Position=210; Antisense; ACCAGATACTCACCCAGATGGATCA
>probe:Drosophila_2:1627107_at:80:67; Interrogation_Position=227; Antisense; ATGGATCACCCGGTGCTTTTCAGAC
>probe:Drosophila_2:1627107_at:146:341; Interrogation_Position=241; Antisense; GCTTTTCAGACCCTTTATGGCATTG
>probe:Drosophila_2:1627107_at:272:699; Interrogation_Position=254; Antisense; TTTATGGCATTGCATCCATGCCGCA
>probe:Drosophila_2:1627107_at:78:561; Interrogation_Position=302; Antisense; GGAAAGCCCAGCTGCAACCAGGTGC
>probe:Drosophila_2:1627107_at:625:79; Interrogation_Position=321; Antisense; AGGTGCTTACCTTCATCAGTCTGTA
>probe:Drosophila_2:1627107_at:314:487; Interrogation_Position=342; Antisense; TGTACGGACCCCACGTGCAGTTGCA
>probe:Drosophila_2:1627107_at:515:77; Interrogation_Position=35; Antisense; AGTGTTTCCTATCAAGTACCAATGT
>probe:Drosophila_2:1627107_at:247:617; Interrogation_Position=363; Antisense; TGCACCTGCAAAATGCGTACGGCTT
>probe:Drosophila_2:1627107_at:550:487; Interrogation_Position=50; Antisense; GTACCAATGTTGTTCTTCCAGGCAC
>probe:Drosophila_2:1627107_at:29:631; Interrogation_Position=66; Antisense; TCCAGGCACACAGATCAGGTATTTA

Paste this into a BLAST search page for me
GGCGAATGTTCATGCCCGAATCGAAGAAGGCCAGCGATCTCCACCAGATATACCATGTGGTCTTCAGTGTTTCCTACCAGATACTCACCCAGATGGATCAATGGATCACCCGGTGCTTTTCAGACGCTTTTCAGACCCTTTATGGCATTGTTTATGGCATTGCATCCATGCCGCAGGAAAGCCCAGCTGCAACCAGGTGCAGGTGCTTACCTTCATCAGTCTGTATGTACGGACCCCACGTGCAGTTGCAAGTGTTTCCTATCAAGTACCAATGTTGCACCTGCAAAATGCGTACGGCTTGTACCAATGTTGTTCTTCCAGGCACTCCAGGCACACAGATCAGGTATTTA

Full Affymetrix probeset data:

Annotations for 1627107_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720