FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627109_at:

>probe:Drosophila_2:1627109_at:422:89; Interrogation_Position=2359; Antisense; AGTCATAGTTGTTGTTGTTTCCCTA
>probe:Drosophila_2:1627109_at:329:31; Interrogation_Position=2391; Antisense; ATAACCGCTTCTGGATTTCGATTAA
>probe:Drosophila_2:1627109_at:205:367; Interrogation_Position=2454; Antisense; GAATCATGAATCACGCAAAGCCACA
>probe:Drosophila_2:1627109_at:43:357; Interrogation_Position=2468; Antisense; GCAAAGCCACAAGCATTTACCCAAA
>probe:Drosophila_2:1627109_at:183:175; Interrogation_Position=2502; Antisense; AAACTATCCGATGCGATTAGGTCAA
>probe:Drosophila_2:1627109_at:395:35; Interrogation_Position=2527; Antisense; ATCAGACGATGAGACTTCCAAGTAA
>probe:Drosophila_2:1627109_at:96:103; Interrogation_Position=2554; Antisense; AGACGAAGACCAAGCCGCCAGGGAG
>probe:Drosophila_2:1627109_at:58:529; Interrogation_Position=2574; Antisense; GGGAGCGTCAATGATCGACTGCATA
>probe:Drosophila_2:1627109_at:211:239; Interrogation_Position=2621; Antisense; AATCAATCGATTTTCTTTCTCCCTT
>probe:Drosophila_2:1627109_at:444:705; Interrogation_Position=2648; Antisense; TTAAAACACGTGGTCACCGTTGTGT
>probe:Drosophila_2:1627109_at:146:131; Interrogation_Position=2663; Antisense; ACCGTTGTGTTGTGTTCCTGTAAGA
>probe:Drosophila_2:1627109_at:403:247; Interrogation_Position=2752; Antisense; AATTGAATTCGAATGGCGGCCACGG
>probe:Drosophila_2:1627109_at:393:257; Interrogation_Position=2772; Antisense; CACGGCGTTCTAGACGCGGACAAAT
>probe:Drosophila_2:1627109_at:209:485; Interrogation_Position=2837; Antisense; GTATGTTGGTTTCCAGTGGACAACC

Paste this into a BLAST search page for me
AGTCATAGTTGTTGTTGTTTCCCTAATAACCGCTTCTGGATTTCGATTAAGAATCATGAATCACGCAAAGCCACAGCAAAGCCACAAGCATTTACCCAAAAAACTATCCGATGCGATTAGGTCAAATCAGACGATGAGACTTCCAAGTAAAGACGAAGACCAAGCCGCCAGGGAGGGGAGCGTCAATGATCGACTGCATAAATCAATCGATTTTCTTTCTCCCTTTTAAAACACGTGGTCACCGTTGTGTACCGTTGTGTTGTGTTCCTGTAAGAAATTGAATTCGAATGGCGGCCACGGCACGGCGTTCTAGACGCGGACAAATGTATGTTGGTTTCCAGTGGACAACC

Full Affymetrix probeset data:

Annotations for 1627109_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720