FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627110_at:

>probe:Drosophila_2:1627110_at:682:21; Interrogation_Position=1993; Antisense; ATATCTGCTATCAGTGTCCCGGGAT
>probe:Drosophila_2:1627110_at:325:451; Interrogation_Position=2015; Antisense; GATCGTCGCTGGTGTCTCTACGAGA
>probe:Drosophila_2:1627110_at:324:565; Interrogation_Position=2040; Antisense; GGCAGGATTCCTCAGTAAGCTATCA
>probe:Drosophila_2:1627110_at:308:551; Interrogation_Position=2093; Antisense; GGAGTTCATACACGCATCATTTGGT
>probe:Drosophila_2:1627110_at:357:273; Interrogation_Position=2110; Antisense; CATTTGGTCGTGTGATTGGTCGCAT
>probe:Drosophila_2:1627110_at:415:729; Interrogation_Position=2125; Antisense; TTGGTCGCATGATGGTCAGTTCTTT
>probe:Drosophila_2:1627110_at:171:647; Interrogation_Position=2140; Antisense; TCAGTTCTTTGTGACGAGCTCAAGG
>probe:Drosophila_2:1627110_at:229:77; Interrogation_Position=2205; Antisense; AGGAGTCTTCGCTAAATGGCTGGCA
>probe:Drosophila_2:1627110_at:714:231; Interrogation_Position=2255; Antisense; AATGAGTCAATCACAGCCGTGGCTT
>probe:Drosophila_2:1627110_at:63:125; Interrogation_Position=2269; Antisense; AGCCGTGGCTTTTTCCAATTCTTAT
>probe:Drosophila_2:1627110_at:334:399; Interrogation_Position=2309; Antisense; GACACATACATTCTTGCTTTGGGCA
>probe:Drosophila_2:1627110_at:51:527; Interrogation_Position=2449; Antisense; GGGAAAACAACTCCAGCTTGCGAGT
>probe:Drosophila_2:1627110_at:730:435; Interrogation_Position=2480; Antisense; GAGGATCATCTGGTACGCATCTACG
>probe:Drosophila_2:1627110_at:728:55; Interrogation_Position=2518; Antisense; ATGAGTTTAGCTCCATATGCATTAA

Paste this into a BLAST search page for me
ATATCTGCTATCAGTGTCCCGGGATGATCGTCGCTGGTGTCTCTACGAGAGGCAGGATTCCTCAGTAAGCTATCAGGAGTTCATACACGCATCATTTGGTCATTTGGTCGTGTGATTGGTCGCATTTGGTCGCATGATGGTCAGTTCTTTTCAGTTCTTTGTGACGAGCTCAAGGAGGAGTCTTCGCTAAATGGCTGGCAAATGAGTCAATCACAGCCGTGGCTTAGCCGTGGCTTTTTCCAATTCTTATGACACATACATTCTTGCTTTGGGCAGGGAAAACAACTCCAGCTTGCGAGTGAGGATCATCTGGTACGCATCTACGATGAGTTTAGCTCCATATGCATTAA

Full Affymetrix probeset data:

Annotations for 1627110_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720