FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627111_at:

>probe:Drosophila_2:1627111_at:543:605; Interrogation_Position=212; Antisense; TGATCTTTGTGAACGCCATCGCGAA
>probe:Drosophila_2:1627111_at:341:377; Interrogation_Position=294; Antisense; GAAGCACAAGACTTTCCTGCGAAAT
>probe:Drosophila_2:1627111_at:251:657; Interrogation_Position=324; Antisense; TAAGGATGTACAGACTCGCCTGCGC
>probe:Drosophila_2:1627111_at:693:523; Interrogation_Position=351; Antisense; GGGCGAAACTGGCATTTGCATCTTT
>probe:Drosophila_2:1627111_at:603:711; Interrogation_Position=366; Antisense; TTGCATCTTTGCTGGCGACGTTACA
>probe:Drosophila_2:1627111_at:567:325; Interrogation_Position=380; Antisense; GCGACGTTACACCTGTGGACATCAT
>probe:Drosophila_2:1627111_at:614:585; Interrogation_Position=395; Antisense; TGGACATCATGTGCCACTTACCAGC
>probe:Drosophila_2:1627111_at:608:147; Interrogation_Position=410; Antisense; ACTTACCAGCCGTCTGCGAGGAGAA
>probe:Drosophila_2:1627111_at:66:437; Interrogation_Position=427; Antisense; GAGGAGAAGGGCATCCCCTATACCT
>probe:Drosophila_2:1627111_at:149:333; Interrogation_Position=513; Antisense; GCTGGTCCGCCAGAACGAGGAGTAC
>probe:Drosophila_2:1627111_at:127:553; Interrogation_Position=564; Antisense; GGAGCTGTCTGCACTAAACATACCC
>probe:Drosophila_2:1627111_at:43:191; Interrogation_Position=580; Antisense; AACATACCCGTCTAGATCTGTAGGA
>probe:Drosophila_2:1627111_at:391:285; Interrogation_Position=597; Antisense; CTGTAGGATTAGTTCCATCGGCTAA
>probe:Drosophila_2:1627111_at:40:319; Interrogation_Position=669; Antisense; GCCGATTCTTTTGGCATCACGAAAT

Paste this into a BLAST search page for me
TGATCTTTGTGAACGCCATCGCGAAGAAGCACAAGACTTTCCTGCGAAATTAAGGATGTACAGACTCGCCTGCGCGGGCGAAACTGGCATTTGCATCTTTTTGCATCTTTGCTGGCGACGTTACAGCGACGTTACACCTGTGGACATCATTGGACATCATGTGCCACTTACCAGCACTTACCAGCCGTCTGCGAGGAGAAGAGGAGAAGGGCATCCCCTATACCTGCTGGTCCGCCAGAACGAGGAGTACGGAGCTGTCTGCACTAAACATACCCAACATACCCGTCTAGATCTGTAGGACTGTAGGATTAGTTCCATCGGCTAAGCCGATTCTTTTGGCATCACGAAAT

Full Affymetrix probeset data:

Annotations for 1627111_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720