FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627114_at:

>probe:Drosophila_2:1627114_at:498:235; Interrogation_Position=1025; Antisense; AATCGAGCGGCTGGAAATGCTGGAC
>probe:Drosophila_2:1627114_at:58:139; Interrogation_Position=1048; Antisense; ACGAGGGTGAACTGCTGCTCCAGCT
>probe:Drosophila_2:1627114_at:251:701; Interrogation_Position=1072; Antisense; TTTTCCAGCACTACTGCCTGGTGGT
>probe:Drosophila_2:1627114_at:101:287; Interrogation_Position=1104; Antisense; CTGGGCGTGGCCTTTCAGGATATAG
>probe:Drosophila_2:1627114_at:385:33; Interrogation_Position=1131; Antisense; ATCACCGTCGAAGAGTTAATGTCCT
>probe:Drosophila_2:1627114_at:34:63; Interrogation_Position=1149; Antisense; ATGTCCTCGCTGAACATTGACTAGG
>probe:Drosophila_2:1627114_at:315:415; Interrogation_Position=1199; Antisense; GAGCCAACCTACTTGGATGCACTAT
>probe:Drosophila_2:1627114_at:415:15; Interrogation_Position=1222; Antisense; ATTTATTGACTCTGCTCGGTTTGGA
>probe:Drosophila_2:1627114_at:166:17; Interrogation_Position=1265; Antisense; ATTTTGCTTCTCAACGTGTTAACCT
>probe:Drosophila_2:1627114_at:463:687; Interrogation_Position=1339; Antisense; TATTTATCCTACACAGAGACCCACT
>probe:Drosophila_2:1627114_at:408:425; Interrogation_Position=1354; Antisense; GAGACCCACTCACAAATGATCTAAT
>probe:Drosophila_2:1627114_at:374:689; Interrogation_Position=1452; Antisense; TATTTTATCACCGAGTTGTGGCACA
>probe:Drosophila_2:1627114_at:265:241; Interrogation_Position=1495; Antisense; AATATGCCATTCATTCATTCCCCAA
>probe:Drosophila_2:1627114_at:414:273; Interrogation_Position=1510; Antisense; CATTCCCCAATTTAAGTGTGCGTTT

Paste this into a BLAST search page for me
AATCGAGCGGCTGGAAATGCTGGACACGAGGGTGAACTGCTGCTCCAGCTTTTTCCAGCACTACTGCCTGGTGGTCTGGGCGTGGCCTTTCAGGATATAGATCACCGTCGAAGAGTTAATGTCCTATGTCCTCGCTGAACATTGACTAGGGAGCCAACCTACTTGGATGCACTATATTTATTGACTCTGCTCGGTTTGGAATTTTGCTTCTCAACGTGTTAACCTTATTTATCCTACACAGAGACCCACTGAGACCCACTCACAAATGATCTAATTATTTTATCACCGAGTTGTGGCACAAATATGCCATTCATTCATTCCCCAACATTCCCCAATTTAAGTGTGCGTTT

Full Affymetrix probeset data:

Annotations for 1627114_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720