FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627116_at:

>probe:Drosophila_2:1627116_at:328:523; Interrogation_Position=362; Antisense; GGGCGTCCTTTCAAATATTCACGGA
>probe:Drosophila_2:1627116_at:389:673; Interrogation_Position=379; Antisense; TTCACGGAATACTCCAAGGTTCTTC
>probe:Drosophila_2:1627116_at:462:251; Interrogation_Position=393; Antisense; CAAGGTTCTTCAAAAGTGCCCAAAG
>probe:Drosophila_2:1627116_at:168:87; Interrogation_Position=407; Antisense; AGTGCCCAAAGTTCTACACGAAAAT
>probe:Drosophila_2:1627116_at:450:695; Interrogation_Position=418; Antisense; TTCTACACGAAAATGGAGCAGTTGC
>probe:Drosophila_2:1627116_at:159:115; Interrogation_Position=434; Antisense; AGCAGTTGCGAGTGGAGCCGACTCC
>probe:Drosophila_2:1627116_at:112:633; Interrogation_Position=459; Antisense; TCCGACGAGACCCACAGATGAAGAC
>probe:Drosophila_2:1627116_at:664:411; Interrogation_Position=467; Antisense; GACCCACAGATGAAGACATAGCATT
>probe:Drosophila_2:1627116_at:621:401; Interrogation_Position=481; Antisense; GACATAGCATTAGACGATTCATTAA
>probe:Drosophila_2:1627116_at:424:463; Interrogation_Position=496; Antisense; GATTCATTAAATGCTATTCTATCCT
>probe:Drosophila_2:1627116_at:194:341; Interrogation_Position=508; Antisense; GCTATTCTATCCTAGTTACCTTTTT
>probe:Drosophila_2:1627116_at:48:199; Interrogation_Position=537; Antisense; AACGACGAAGTTAGGCAAGAAATAT
>probe:Drosophila_2:1627116_at:484:247; Interrogation_Position=594; Antisense; AATTGCCTATTAAAACTGCGTCCAT
>probe:Drosophila_2:1627116_at:565:283; Interrogation_Position=609; Antisense; CTGCGTCCATCCCACTAATATATAG

Paste this into a BLAST search page for me
GGGCGTCCTTTCAAATATTCACGGATTCACGGAATACTCCAAGGTTCTTCCAAGGTTCTTCAAAAGTGCCCAAAGAGTGCCCAAAGTTCTACACGAAAATTTCTACACGAAAATGGAGCAGTTGCAGCAGTTGCGAGTGGAGCCGACTCCTCCGACGAGACCCACAGATGAAGACGACCCACAGATGAAGACATAGCATTGACATAGCATTAGACGATTCATTAAGATTCATTAAATGCTATTCTATCCTGCTATTCTATCCTAGTTACCTTTTTAACGACGAAGTTAGGCAAGAAATATAATTGCCTATTAAAACTGCGTCCATCTGCGTCCATCCCACTAATATATAG

Full Affymetrix probeset data:

Annotations for 1627116_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720