Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627117_a_at:

>probe:Drosophila_2:1627117_a_at:298:335; Interrogation_Position=442; Antisense; GCTGCAGCGCCGCAAGGTAAACGAC
>probe:Drosophila_2:1627117_a_at:123:135; Interrogation_Position=462; Antisense; ACGACGGTCATGTGGTAGTCATCAA
>probe:Drosophila_2:1627117_a_at:385:241; Interrogation_Position=485; Antisense; AATAGTGTGGTAGGCCACTCCGTTC
>probe:Drosophila_2:1627117_a_at:257:571; Interrogation_Position=521; Antisense; GGCTTCAGCCTGAACATGTACGCGC
>probe:Drosophila_2:1627117_a_at:596:315; Interrogation_Position=566; Antisense; GCCTTGACCGAAATCCTGCGTCAGG
>probe:Drosophila_2:1627117_a_at:688:305; Interrogation_Position=580; Antisense; CCTGCGTCAGGAGTTCATCAAGAAG
>probe:Drosophila_2:1627117_a_at:649:371; Interrogation_Position=601; Antisense; GAAGGGCACTCAAACAAAGATCACG
>probe:Drosophila_2:1627117_a_at:82:173; Interrogation_Position=616; Antisense; AAAGATCACGAGCATCAGTCCTGGT
>probe:Drosophila_2:1627117_a_at:444:267; Interrogation_Position=631; Antisense; CAGTCCTGGTGTAGTGGCCACTGAA
>probe:Drosophila_2:1627117_a_at:260:523; Interrogation_Position=644; Antisense; GTGGCCACTGAAATTTTCGAAGCCG
>probe:Drosophila_2:1627117_a_at:220:695; Interrogation_Position=658; Antisense; TTTCGAAGCCGGATCCTGGGAGCAA
>probe:Drosophila_2:1627117_a_at:436:301; Interrogation_Position=695; Antisense; CCCATGCTGCGATCGGAGGATATAG
>probe:Drosophila_2:1627117_a_at:336:459; Interrogation_Position=713; Antisense; GATATAGCCGATGCGGTGACCTACT
>probe:Drosophila_2:1627117_a_at:572:553; Interrogation_Position=769; Antisense; GGAGCTCATAATCAAGCCGGTTGGT

Paste this into a BLAST search page for me
GCTGCAGCGCCGCAAGGTAAACGACACGACGGTCATGTGGTAGTCATCAAAATAGTGTGGTAGGCCACTCCGTTCGGCTTCAGCCTGAACATGTACGCGCGCCTTGACCGAAATCCTGCGTCAGGCCTGCGTCAGGAGTTCATCAAGAAGGAAGGGCACTCAAACAAAGATCACGAAAGATCACGAGCATCAGTCCTGGTCAGTCCTGGTGTAGTGGCCACTGAAGTGGCCACTGAAATTTTCGAAGCCGTTTCGAAGCCGGATCCTGGGAGCAACCCATGCTGCGATCGGAGGATATAGGATATAGCCGATGCGGTGACCTACTGGAGCTCATAATCAAGCCGGTTGGT

Full Affymetrix probeset data:

Annotations for 1627117_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime