Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627118_at:

>probe:Drosophila_2:1627118_at:65:455; Interrogation_Position=1544; Antisense; GATAAGGCATTCCATTACTCGTACT
>probe:Drosophila_2:1627118_at:685:399; Interrogation_Position=1583; Antisense; GACATGTCTGGTGGCGTTCTTAGTA
>probe:Drosophila_2:1627118_at:338:91; Interrogation_Position=1604; Antisense; AGTACCGTCGTGGATTTGCAGCACC
>probe:Drosophila_2:1627118_at:426:695; Interrogation_Position=1631; Antisense; TTTCTGTCCACAGGAGCAGCCAGTG
>probe:Drosophila_2:1627118_at:709:353; Interrogation_Position=1646; Antisense; GCAGCCAGTGGCAACGGTTCGAAAT
>probe:Drosophila_2:1627118_at:524:705; Interrogation_Position=1663; Antisense; TTCGAAATCCCCAACAGAACCAGGT
>probe:Drosophila_2:1627118_at:620:379; Interrogation_Position=1679; Antisense; GAACCAGGTGCTCTTACAATGGACT
>probe:Drosophila_2:1627118_at:156:587; Interrogation_Position=1698; Antisense; TGGACTATTACCACGATCTGGCGGA
>probe:Drosophila_2:1627118_at:347:41; Interrogation_Position=1713; Antisense; ATCTGGCGGAGTTGTGCTTCCCCAA
>probe:Drosophila_2:1627118_at:63:313; Interrogation_Position=1748; Antisense; GCCAAAGTGCGCGTCTACGAGTTGT
>probe:Drosophila_2:1627118_at:399:427; Interrogation_Position=1766; Antisense; GAGTTGTATTGCATTCATCTGGGAC
>probe:Drosophila_2:1627118_at:153:41; Interrogation_Position=1782; Antisense; ATCTGGGACTGGTAACCGCCACATG
>probe:Drosophila_2:1627118_at:375:3; Interrogation_Position=1878; Antisense; ATTGGCCATTGGTCATTCCAGATTT
>probe:Drosophila_2:1627118_at:142:491; Interrogation_Position=1918; Antisense; GTCAATTTTCGAGACTCCTAGGCGA

Paste this into a BLAST search page for me
GATAAGGCATTCCATTACTCGTACTGACATGTCTGGTGGCGTTCTTAGTAAGTACCGTCGTGGATTTGCAGCACCTTTCTGTCCACAGGAGCAGCCAGTGGCAGCCAGTGGCAACGGTTCGAAATTTCGAAATCCCCAACAGAACCAGGTGAACCAGGTGCTCTTACAATGGACTTGGACTATTACCACGATCTGGCGGAATCTGGCGGAGTTGTGCTTCCCCAAGCCAAAGTGCGCGTCTACGAGTTGTGAGTTGTATTGCATTCATCTGGGACATCTGGGACTGGTAACCGCCACATGATTGGCCATTGGTCATTCCAGATTTGTCAATTTTCGAGACTCCTAGGCGA

Full Affymetrix probeset data:

Annotations for 1627118_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime