Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627119_at:

>probe:Drosophila_2:1627119_at:56:211; Interrogation_Position=331; Antisense; AAGAATAACTTCTTTCGCCATCCAG
>probe:Drosophila_2:1627119_at:285:459; Interrogation_Position=356; Antisense; GATATCCCAATAGCGCTGGTCACGA
>probe:Drosophila_2:1627119_at:149:591; Interrogation_Position=372; Antisense; TGGTCACGACATCGGACTCATTCGC
>probe:Drosophila_2:1627119_at:515:139; Interrogation_Position=404; Antisense; ACGTCAGCTTCACCAATCTGATCAA
>probe:Drosophila_2:1627119_at:87:641; Interrogation_Position=420; Antisense; TCTGATCAACAAAGTTTCGCTGCCC
>probe:Drosophila_2:1627119_at:430:719; Interrogation_Position=435; Antisense; TTCGCTGCCCAAGTTCAGCCAAAAA
>probe:Drosophila_2:1627119_at:711:233; Interrogation_Position=572; Antisense; AATGCGCCAGGTCATACGGATCGGT
>probe:Drosophila_2:1627119_at:597:545; Interrogation_Position=589; Antisense; GGATCGGTGGCCAGCACTGATATGT
>probe:Drosophila_2:1627119_at:362:259; Interrogation_Position=624; Antisense; CACCGATGGCAAGTCCGTGTGCGGT
>probe:Drosophila_2:1627119_at:73:553; Interrogation_Position=661; Antisense; GGAGCACTGGTCACTCACGACAATC
>probe:Drosophila_2:1627119_at:13:253; Interrogation_Position=691; Antisense; CAAGTGGGCGTTATCACCTTTGCAT
>probe:Drosophila_2:1627119_at:336:41; Interrogation_Position=718; Antisense; ATCGGCTGCAAGTCTGGACCATCGG
>probe:Drosophila_2:1627119_at:436:517; Interrogation_Position=752; Antisense; GTGTGTCCGATCACTTGGACTGGAT
>probe:Drosophila_2:1627119_at:384:373; Interrogation_Position=783; Antisense; GAAGTCGGGAATTGCCTATTACTAA

Paste this into a BLAST search page for me
AAGAATAACTTCTTTCGCCATCCAGGATATCCCAATAGCGCTGGTCACGATGGTCACGACATCGGACTCATTCGCACGTCAGCTTCACCAATCTGATCAATCTGATCAACAAAGTTTCGCTGCCCTTCGCTGCCCAAGTTCAGCCAAAAAAATGCGCCAGGTCATACGGATCGGTGGATCGGTGGCCAGCACTGATATGTCACCGATGGCAAGTCCGTGTGCGGTGGAGCACTGGTCACTCACGACAATCCAAGTGGGCGTTATCACCTTTGCATATCGGCTGCAAGTCTGGACCATCGGGTGTGTCCGATCACTTGGACTGGATGAAGTCGGGAATTGCCTATTACTAA

Full Affymetrix probeset data:

Annotations for 1627119_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime