FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627120_at:

>probe:Drosophila_2:1627120_at:7:529; Interrogation_Position=224; Antisense; GGGACAGTCTGCTGCACACTTCATT
>probe:Drosophila_2:1627120_at:560:157; Interrogation_Position=239; Antisense; ACACTTCATTCGATTTGACCACGGC
>probe:Drosophila_2:1627120_at:701:723; Interrogation_Position=253; Antisense; TTGACCACGGCCCAGTCGATTGTGA
>probe:Drosophila_2:1627120_at:371:395; Interrogation_Position=300; Antisense; GAAATTGGCCCAGAGCTGCGTCCGT
>probe:Drosophila_2:1627120_at:122:329; Interrogation_Position=317; Antisense; GCGTCCGTGATCTGGATACCGATGA
>probe:Drosophila_2:1627120_at:99:659; Interrogation_Position=342; Antisense; TAAGCTGTGCTTTCTGCGCGTGAAA
>probe:Drosophila_2:1627120_at:555:303; Interrogation_Position=369; Antisense; CCGCAAGCACGAATTCCTGGTTAGT
>probe:Drosophila_2:1627120_at:537:561; Interrogation_Position=399; Antisense; GGAAGCCTTCACTGTGACCGTGGTA
>probe:Drosophila_2:1627120_at:683:557; Interrogation_Position=460; Antisense; GGACATTGTTGCTTGCTGGTGGACA
>probe:Drosophila_2:1627120_at:76:145; Interrogation_Position=531; Antisense; ACTCGCTCATTGTTGATGCTTTCGT
>probe:Drosophila_2:1627120_at:341:441; Interrogation_Position=545; Antisense; GATGCTTTCGTTGAAGATCGTCGTA
>probe:Drosophila_2:1627120_at:535:451; Interrogation_Position=560; Antisense; GATCGTCGTACATGTTTAACCAACC
>probe:Drosophila_2:1627120_at:265:385; Interrogation_Position=643; Antisense; GAACATTTATGCGTGTGACCGGACA
>probe:Drosophila_2:1627120_at:273:357; Interrogation_Position=703; Antisense; GCACAGATGCCGATGTCAGCCATTA

Paste this into a BLAST search page for me
GGGACAGTCTGCTGCACACTTCATTACACTTCATTCGATTTGACCACGGCTTGACCACGGCCCAGTCGATTGTGAGAAATTGGCCCAGAGCTGCGTCCGTGCGTCCGTGATCTGGATACCGATGATAAGCTGTGCTTTCTGCGCGTGAAACCGCAAGCACGAATTCCTGGTTAGTGGAAGCCTTCACTGTGACCGTGGTAGGACATTGTTGCTTGCTGGTGGACAACTCGCTCATTGTTGATGCTTTCGTGATGCTTTCGTTGAAGATCGTCGTAGATCGTCGTACATGTTTAACCAACCGAACATTTATGCGTGTGACCGGACAGCACAGATGCCGATGTCAGCCATTA

Full Affymetrix probeset data:

Annotations for 1627120_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720