FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627122_at:

>probe:Drosophila_2:1627122_at:688:623; Interrogation_Position=5762; Antisense; TCGAACACCTTGTGGTTTCCTTAAT
>probe:Drosophila_2:1627122_at:518:595; Interrogation_Position=5772; Antisense; TGTGGTTTCCTTAATTAGTTGCTAA
>probe:Drosophila_2:1627122_at:461:245; Interrogation_Position=5784; Antisense; AATTAGTTGCTAAGTATCCACGATA
>probe:Drosophila_2:1627122_at:507:91; Interrogation_Position=5796; Antisense; AGTATCCACGATAAACACACGAATA
>probe:Drosophila_2:1627122_at:447:363; Interrogation_Position=5816; Antisense; GAATACATTAAACACCCACACGATA
>probe:Drosophila_2:1627122_at:574:187; Interrogation_Position=5826; Antisense; AACACCCACACGATACTTGATTATG
>probe:Drosophila_2:1627122_at:508:237; Interrogation_Position=5876; Antisense; AATCTGTAGCTAAGTGTAAGCCTAA
>probe:Drosophila_2:1627122_at:64:203; Interrogation_Position=5893; Antisense; AAGCCTAATTTCAGTGTAGTCTTTA
>probe:Drosophila_2:1627122_at:312:385; Interrogation_Position=5922; Antisense; GAAAGAGCATGCTTTAGCTTTAGCT
>probe:Drosophila_2:1627122_at:595:115; Interrogation_Position=5937; Antisense; AGCTTTAGCTTTACCCTAACATACG
>probe:Drosophila_2:1627122_at:38:27; Interrogation_Position=5999; Antisense; ATAGCCGCTGTACAATTACTTGATC
>probe:Drosophila_2:1627122_at:104:149; Interrogation_Position=6016; Antisense; ACTTGATCTTTAGCATTAACACTTG
>probe:Drosophila_2:1627122_at:324:481; Interrogation_Position=6073; Antisense; GTTTGTGTATATTCTTTTCGTTGGT
>probe:Drosophila_2:1627122_at:253:311; Interrogation_Position=6333; Antisense; GCCAACAATTGTAAAACGTAGCTGA

Paste this into a BLAST search page for me
TCGAACACCTTGTGGTTTCCTTAATTGTGGTTTCCTTAATTAGTTGCTAAAATTAGTTGCTAAGTATCCACGATAAGTATCCACGATAAACACACGAATAGAATACATTAAACACCCACACGATAAACACCCACACGATACTTGATTATGAATCTGTAGCTAAGTGTAAGCCTAAAAGCCTAATTTCAGTGTAGTCTTTAGAAAGAGCATGCTTTAGCTTTAGCTAGCTTTAGCTTTACCCTAACATACGATAGCCGCTGTACAATTACTTGATCACTTGATCTTTAGCATTAACACTTGGTTTGTGTATATTCTTTTCGTTGGTGCCAACAATTGTAAAACGTAGCTGA

Full Affymetrix probeset data:

Annotations for 1627122_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720