FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627123_at:

>probe:Drosophila_2:1627123_at:439:57; Interrogation_Position=1002; Antisense; ATGAGACTGACCTGCTTGTGATTGA
>probe:Drosophila_2:1627123_at:605:157; Interrogation_Position=1047; Antisense; ACACAAATCTGAATGCCCGCTTCGG
>probe:Drosophila_2:1627123_at:290:425; Interrogation_Position=1076; Antisense; GAGACCCTCAAGTTGGCCGTGATAA
>probe:Drosophila_2:1627123_at:364:457; Interrogation_Position=1136; Antisense; GATATGTTCGCCGTCGTCTGCAAGT
>probe:Drosophila_2:1627123_at:392:499; Interrogation_Position=1151; Antisense; GTCTGCAAGTTCGAACCGGCTGCGC
>probe:Drosophila_2:1627123_at:368:117; Interrogation_Position=1178; Antisense; AGCTAGTCCAGGAGCCACTACGTTC
>probe:Drosophila_2:1627123_at:695:257; Interrogation_Position=1193; Antisense; CACTACGTTCATTGTTATCCCTTGT
>probe:Drosophila_2:1627123_at:96:653; Interrogation_Position=1232; Antisense; TATCCCCGGTCCTTGTTCAGTTTGA
>probe:Drosophila_2:1627123_at:5:691; Interrogation_Position=1252; Antisense; TTTGAAATCATTGTTACCGCCACCC
>probe:Drosophila_2:1627123_at:181:233; Interrogation_Position=1351; Antisense; AATGCAAGTGCTTTCGTGGTCACCC
>probe:Drosophila_2:1627123_at:213:613; Interrogation_Position=849; Antisense; TGAAATCCTTGCTGGACGACTGCTC
>probe:Drosophila_2:1627123_at:718:77; Interrogation_Position=885; Antisense; AGGTCCTGGAGCAGGCCTGGTCAAA
>probe:Drosophila_2:1627123_at:455:155; Interrogation_Position=913; Antisense; ACAACTACTGGTCTATGCAAATGGA
>probe:Drosophila_2:1627123_at:305:169; Interrogation_Position=931; Antisense; AAATGGACAGACTGGTCCCTGCCTG

Paste this into a BLAST search page for me
ATGAGACTGACCTGCTTGTGATTGAACACAAATCTGAATGCCCGCTTCGGGAGACCCTCAAGTTGGCCGTGATAAGATATGTTCGCCGTCGTCTGCAAGTGTCTGCAAGTTCGAACCGGCTGCGCAGCTAGTCCAGGAGCCACTACGTTCCACTACGTTCATTGTTATCCCTTGTTATCCCCGGTCCTTGTTCAGTTTGATTTGAAATCATTGTTACCGCCACCCAATGCAAGTGCTTTCGTGGTCACCCTGAAATCCTTGCTGGACGACTGCTCAGGTCCTGGAGCAGGCCTGGTCAAAACAACTACTGGTCTATGCAAATGGAAAATGGACAGACTGGTCCCTGCCTG

Full Affymetrix probeset data:

Annotations for 1627123_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720