FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627124_at:

>probe:Drosophila_2:1627124_at:26:663; Interrogation_Position=1610; Antisense; TAAAGTTAGCCCTTGATTGATAATC
>probe:Drosophila_2:1627124_at:171:29; Interrogation_Position=1648; Antisense; ATACTTTACTATGCCTTTGATTCAA
>probe:Drosophila_2:1627124_at:303:603; Interrogation_Position=1665; Antisense; TGATTCAAATCCTCACATCCTTTGC
>probe:Drosophila_2:1627124_at:578:269; Interrogation_Position=1680; Antisense; CATCCTTTGCTTTTGTTTATCGTTA
>probe:Drosophila_2:1627124_at:9:479; Interrogation_Position=1694; Antisense; GTTTATCGTTATACATTCGCTTAGA
>probe:Drosophila_2:1627124_at:428:15; Interrogation_Position=1785; Antisense; ATTTTATTGCTTGACTCGATCGTTA
>probe:Drosophila_2:1627124_at:592:479; Interrogation_Position=1858; Antisense; GTATTAGCTGGATAAACGACTTCTA
>probe:Drosophila_2:1627124_at:640:257; Interrogation_Position=1901; Antisense; CACAAATGCAGTGCGTTCCGTGACT
>probe:Drosophila_2:1627124_at:523:325; Interrogation_Position=1913; Antisense; GCGTTCCGTGACTGTAAGTGCCAAT
>probe:Drosophila_2:1627124_at:348:231; Interrogation_Position=1935; Antisense; AATGTCTTGGCCTTACAGCTGCGAA
>probe:Drosophila_2:1627124_at:384:335; Interrogation_Position=1952; Antisense; GCTGCGAAACGCACTGCACATGTTT
>probe:Drosophila_2:1627124_at:354:465; Interrogation_Position=1993; Antisense; GATTGTTTGCTTTTGCTTACACTTT
>probe:Drosophila_2:1627124_at:679:689; Interrogation_Position=2004; Antisense; TTTGCTTACACTTTGACGTTCCCTA
>probe:Drosophila_2:1627124_at:397:409; Interrogation_Position=2018; Antisense; GACGTTCCCTATTAATTCACTTAAG

Paste this into a BLAST search page for me
TAAAGTTAGCCCTTGATTGATAATCATACTTTACTATGCCTTTGATTCAATGATTCAAATCCTCACATCCTTTGCCATCCTTTGCTTTTGTTTATCGTTAGTTTATCGTTATACATTCGCTTAGAATTTTATTGCTTGACTCGATCGTTAGTATTAGCTGGATAAACGACTTCTACACAAATGCAGTGCGTTCCGTGACTGCGTTCCGTGACTGTAAGTGCCAATAATGTCTTGGCCTTACAGCTGCGAAGCTGCGAAACGCACTGCACATGTTTGATTGTTTGCTTTTGCTTACACTTTTTTGCTTACACTTTGACGTTCCCTAGACGTTCCCTATTAATTCACTTAAG

Full Affymetrix probeset data:

Annotations for 1627124_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720