FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627125_at:

>probe:Drosophila_2:1627125_at:645:61; Interrogation_Position=1013; Antisense; ATGTCCGCCTCGAAGAAGCCTTTGA
>probe:Drosophila_2:1627125_at:345:249; Interrogation_Position=1115; Antisense; CAATGGCCATGTTCGGAAACCTGAT
>probe:Drosophila_2:1627125_at:247:669; Interrogation_Position=594; Antisense; TACGGAACTGCGTCAGGTGATCGAT
>probe:Drosophila_2:1627125_at:682:379; Interrogation_Position=619; Antisense; GAAGCCAAGGATCTGCTCTTAAGTC
>probe:Drosophila_2:1627125_at:622:171; Interrogation_Position=637; Antisense; TTAAGTCCCCGGCATCAGGGAGTTT
>probe:Drosophila_2:1627125_at:629:251; Interrogation_Position=669; Antisense; CAAGTGTTGTTCGTTGGCGGATCAG
>probe:Drosophila_2:1627125_at:451:265; Interrogation_Position=715; Antisense; CAGAGCCAACTGCAGACGATTATGA
>probe:Drosophila_2:1627125_at:191:571; Interrogation_Position=787; Antisense; GGCTACTACTTGTCCTCGGTTGGCA
>probe:Drosophila_2:1627125_at:317:467; Interrogation_Position=805; Antisense; GTTGGCACCTGTTACTTGGCATATA
>probe:Drosophila_2:1627125_at:362:345; Interrogation_Position=823; Antisense; GCATATAGTATCCTCAAGCATGGCT
>probe:Drosophila_2:1627125_at:376:397; Interrogation_Position=864; Antisense; GACACTGAGTACTGTAATCCTGGCG
>probe:Drosophila_2:1627125_at:696:233; Interrogation_Position=879; Antisense; AATCCTGGCGTACTCTTGGTGTTTT
>probe:Drosophila_2:1627125_at:45:245; Interrogation_Position=928; Antisense; AATTTATCGGTCATGCTCCACGTAC
>probe:Drosophila_2:1627125_at:237:243; Interrogation_Position=996; Antisense; AATATTCGTTGGCTTGGATGTCCGC

Paste this into a BLAST search page for me
ATGTCCGCCTCGAAGAAGCCTTTGACAATGGCCATGTTCGGAAACCTGATTACGGAACTGCGTCAGGTGATCGATGAAGCCAAGGATCTGCTCTTAAGTCTTAAGTCCCCGGCATCAGGGAGTTTCAAGTGTTGTTCGTTGGCGGATCAGCAGAGCCAACTGCAGACGATTATGAGGCTACTACTTGTCCTCGGTTGGCAGTTGGCACCTGTTACTTGGCATATAGCATATAGTATCCTCAAGCATGGCTGACACTGAGTACTGTAATCCTGGCGAATCCTGGCGTACTCTTGGTGTTTTAATTTATCGGTCATGCTCCACGTACAATATTCGTTGGCTTGGATGTCCGC

Full Affymetrix probeset data:

Annotations for 1627125_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720