Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627128_at:

>probe:Drosophila_2:1627128_at:46:525; Interrogation_Position=1041; Antisense; GGGCGACCTGCAGCTGAGCAACTAT
>probe:Drosophila_2:1627128_at:201:271; Interrogation_Position=1104; Antisense; CATCGTCAAGAAGTGCGGCTGCCAT
>probe:Drosophila_2:1627128_at:270:233; Interrogation_Position=1171; Antisense; AATCTAAACGACACCTTCTGCTATT
>probe:Drosophila_2:1627128_at:566:715; Interrogation_Position=1186; Antisense; TTCTGCTATTCTGCCAACTATGGTG
>probe:Drosophila_2:1627128_at:151:193; Interrogation_Position=1201; Antisense; AACTATGGTGGTGTGCGCTGTGATC
>probe:Drosophila_2:1627128_at:326:87; Interrogation_Position=1226; Antisense; AGTGCCTGCCCAATTGCTATGATGT
>probe:Drosophila_2:1627128_at:59:117; Interrogation_Position=1289; Antisense; AGCATAAGTACTCAGTCAGCCGCTT
>probe:Drosophila_2:1627128_at:72:645; Interrogation_Position=1313; Antisense; TCTACTCTCCGGAATTGCTTAACAA
>probe:Drosophila_2:1627128_at:605:159; Interrogation_Position=1334; Antisense; ACAACGACAGTTTTGTGCTCCGGGT
>probe:Drosophila_2:1627128_at:440:337; Interrogation_Position=1350; Antisense; GCTCCGGGTCTATTTGGCCAAACAA
>probe:Drosophila_2:1627128_at:111:579; Interrogation_Position=874; Antisense; GGCCTGATAGTACTGGTTCACCATC
>probe:Drosophila_2:1627128_at:311:271; Interrogation_Position=895; Antisense; CATCCCATGGACTACGTGACTGAGG
>probe:Drosophila_2:1627128_at:353:493; Interrogation_Position=932; Antisense; TGACCATTACCGCTCAATCCGAAAG
>probe:Drosophila_2:1627128_at:289:393; Interrogation_Position=952; Antisense; GAAAGCTTTGTGGAGGTATCGCCCA

Paste this into a BLAST search page for me
GGGCGACCTGCAGCTGAGCAACTATCATCGTCAAGAAGTGCGGCTGCCATAATCTAAACGACACCTTCTGCTATTTTCTGCTATTCTGCCAACTATGGTGAACTATGGTGGTGTGCGCTGTGATCAGTGCCTGCCCAATTGCTATGATGTAGCATAAGTACTCAGTCAGCCGCTTTCTACTCTCCGGAATTGCTTAACAAACAACGACAGTTTTGTGCTCCGGGTGCTCCGGGTCTATTTGGCCAAACAAGGCCTGATAGTACTGGTTCACCATCCATCCCATGGACTACGTGACTGAGGTGACCATTACCGCTCAATCCGAAAGGAAAGCTTTGTGGAGGTATCGCCCA

Full Affymetrix probeset data:

Annotations for 1627128_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime