FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627130_at:

>probe:Drosophila_2:1627130_at:249:449; Interrogation_Position=1067; Antisense; GATCCTCGGAGTTGGAGATGCTCTC
>probe:Drosophila_2:1627130_at:375:99; Interrogation_Position=1082; Antisense; AGATGCTCTCCCTAATGGCAGGACA
>probe:Drosophila_2:1627130_at:515:221; Interrogation_Position=1123; Antisense; AAGGTGTGCTTCAGTCCCAGTGGCT
>probe:Drosophila_2:1627130_at:643:563; Interrogation_Position=1197; Antisense; GGAATCCGGACAGTGCTCCCAAGTG
>probe:Drosophila_2:1627130_at:180:513; Interrogation_Position=1238; Antisense; GTGAGGTGTTCAGCTGCGCCTACAG
>probe:Drosophila_2:1627130_at:325:315; Interrogation_Position=1288; Antisense; GCCTCCAAGGATAACAGCTGTCGGT
>probe:Drosophila_2:1627130_at:264:655; Interrogation_Position=744; Antisense; TAATCGCGATGGTCAGATGCTGCTC
>probe:Drosophila_2:1627130_at:441:129; Interrogation_Position=769; Antisense; ACCGGCTCATTCGATCATTCAGCAG
>probe:Drosophila_2:1627130_at:96:645; Interrogation_Position=819; Antisense; TCTAGGGCATCAGTTGCGAGGCCAT
>probe:Drosophila_2:1627130_at:699:439; Interrogation_Position=836; Antisense; GAGGCCATAGCGCTGAGTTATCCAA
>probe:Drosophila_2:1627130_at:629:121; Interrogation_Position=877; Antisense; AGCGGATCTCTGATTGCTACTGGCT
>probe:Drosophila_2:1627130_at:2:323; Interrogation_Position=916; Antisense; GCGCGGATCTGGGACACTCGAAAGC
>probe:Drosophila_2:1627130_at:117:267; Interrogation_Position=946; Antisense; CAGGAACTTTATCTGGCTGCCAGGC
>probe:Drosophila_2:1627130_at:607:607; Interrogation_Position=978; Antisense; TGAGGTGCTCGATGTCAGCTTCGAT

Paste this into a BLAST search page for me
GATCCTCGGAGTTGGAGATGCTCTCAGATGCTCTCCCTAATGGCAGGACAAAGGTGTGCTTCAGTCCCAGTGGCTGGAATCCGGACAGTGCTCCCAAGTGGTGAGGTGTTCAGCTGCGCCTACAGGCCTCCAAGGATAACAGCTGTCGGTTAATCGCGATGGTCAGATGCTGCTCACCGGCTCATTCGATCATTCAGCAGTCTAGGGCATCAGTTGCGAGGCCATGAGGCCATAGCGCTGAGTTATCCAAAGCGGATCTCTGATTGCTACTGGCTGCGCGGATCTGGGACACTCGAAAGCCAGGAACTTTATCTGGCTGCCAGGCTGAGGTGCTCGATGTCAGCTTCGAT

Full Affymetrix probeset data:

Annotations for 1627130_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720