Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627132_at:

>probe:Drosophila_2:1627132_at:518:495; Interrogation_Position=1469; Antisense; GTCACCAGCGATATGTGCATCTCAC
>probe:Drosophila_2:1627132_at:554:265; Interrogation_Position=1570; Antisense; CATACGGGCGAGGTGCTTTACAAGT
>probe:Drosophila_2:1627132_at:675:279; Interrogation_Position=1598; Antisense; CTCACTGCCCGAAAACATTTAACTC
>probe:Drosophila_2:1627132_at:142:325; Interrogation_Position=1627; Antisense; GCGAATCAGCACACGCATCGTAGGA
>probe:Drosophila_2:1627132_at:338:221; Interrogation_Position=1651; Antisense; AAGTGTCATCCCAAAGAGTTCGAGG
>probe:Drosophila_2:1627132_at:547:563; Interrogation_Position=1682; Antisense; GGAAGGCACGCACCGAGAAACGAAA
>probe:Drosophila_2:1627132_at:79:77; Interrogation_Position=1718; Antisense; AGGAGACACCCAGCGTGTTGACCAT
>probe:Drosophila_2:1627132_at:159:117; Interrogation_Position=1771; Antisense; AGCATTCTGCTGACAAATACCGAGG
>probe:Drosophila_2:1627132_at:140:529; Interrogation_Position=1806; Antisense; GGGAGATACCATCGAGTTCACTCTG
>probe:Drosophila_2:1627132_at:420:93; Interrogation_Position=1820; Antisense; AGTTCACTCTGTGTCTCAGTGCCGA
>probe:Drosophila_2:1627132_at:302:499; Interrogation_Position=1832; Antisense; GTCTCAGTGCCGATACCACAGATTG
>probe:Drosophila_2:1627132_at:719:689; Interrogation_Position=1864; Antisense; TTTCTGTTACATTTGGTGTACCCGT
>probe:Drosophila_2:1627132_at:391:511; Interrogation_Position=1879; Antisense; GTGTACCCGTAACCAGCACAGTTAA
>probe:Drosophila_2:1627132_at:159:93; Interrogation_Position=2013; Antisense; AGATCCTTAAGCTAGCAGCGTTTAA

Paste this into a BLAST search page for me
GTCACCAGCGATATGTGCATCTCACCATACGGGCGAGGTGCTTTACAAGTCTCACTGCCCGAAAACATTTAACTCGCGAATCAGCACACGCATCGTAGGAAAGTGTCATCCCAAAGAGTTCGAGGGGAAGGCACGCACCGAGAAACGAAAAGGAGACACCCAGCGTGTTGACCATAGCATTCTGCTGACAAATACCGAGGGGGAGATACCATCGAGTTCACTCTGAGTTCACTCTGTGTCTCAGTGCCGAGTCTCAGTGCCGATACCACAGATTGTTTCTGTTACATTTGGTGTACCCGTGTGTACCCGTAACCAGCACAGTTAAAGATCCTTAAGCTAGCAGCGTTTAA

Full Affymetrix probeset data:

Annotations for 1627132_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime