FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627133_at:

>probe:Drosophila_2:1627133_at:71:565; Interrogation_Position=2140; Antisense; GGAATAGCCTTTTGTACGATACCCA
>probe:Drosophila_2:1627133_at:402:137; Interrogation_Position=2155; Antisense; ACGATACCCATTTTATTGGCCGGCA
>probe:Drosophila_2:1627133_at:334:123; Interrogation_Position=2180; Antisense; AGCCGATATATCTCATGCGTCGTCG
>probe:Drosophila_2:1627133_at:413:233; Interrogation_Position=2268; Antisense; AATGCGATCCACAATGCGGTACACG
>probe:Drosophila_2:1627133_at:452:543; Interrogation_Position=2366; Antisense; GGATTCACTCTGGAATTCACACTAT
>probe:Drosophila_2:1627133_at:694:139; Interrogation_Position=2395; Antisense; ACGGTATTGGGCTCAGTATCGCATA
>probe:Drosophila_2:1627133_at:327:155; Interrogation_Position=2419; Antisense; ACAGCCTCCTATCTTCGATTGTGGG
>probe:Drosophila_2:1627133_at:160:467; Interrogation_Position=2451; Antisense; GTTGGCACACGATCAGCTGTCCGAT
>probe:Drosophila_2:1627133_at:595:631; Interrogation_Position=2477; Antisense; TCCTGTGGCACATGGTTCTGACCAA
>probe:Drosophila_2:1627133_at:87:541; Interrogation_Position=2490; Antisense; GGTTCTGACCAAGGGATTCGCCAAC
>probe:Drosophila_2:1627133_at:219:3; Interrogation_Position=2523; Antisense; ATTGTACTATGGTGTGCCCGTGCTC
>probe:Drosophila_2:1627133_at:574:65; Interrogation_Position=2599; Antisense; ATGGAGGGATTGAGCGCCTTCCTGC
>probe:Drosophila_2:1627133_at:679:289; Interrogation_Position=2675; Antisense; CGGGCGAGTCGTTCAAGGCATTCAA
>probe:Drosophila_2:1627133_at:269:69; Interrogation_Position=2690; Antisense; AGGCATTCAATTTCCCGACGTCAAA

Paste this into a BLAST search page for me
GGAATAGCCTTTTGTACGATACCCAACGATACCCATTTTATTGGCCGGCAAGCCGATATATCTCATGCGTCGTCGAATGCGATCCACAATGCGGTACACGGGATTCACTCTGGAATTCACACTATACGGTATTGGGCTCAGTATCGCATAACAGCCTCCTATCTTCGATTGTGGGGTTGGCACACGATCAGCTGTCCGATTCCTGTGGCACATGGTTCTGACCAAGGTTCTGACCAAGGGATTCGCCAACATTGTACTATGGTGTGCCCGTGCTCATGGAGGGATTGAGCGCCTTCCTGCCGGGCGAGTCGTTCAAGGCATTCAAAGGCATTCAATTTCCCGACGTCAAA

Full Affymetrix probeset data:

Annotations for 1627133_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720