FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627134_at:

>probe:Drosophila_2:1627134_at:595:81; Interrogation_Position=1532; Antisense; AGGGACAGGTTCTTGACACTCTAGC
>probe:Drosophila_2:1627134_at:305:397; Interrogation_Position=1546; Antisense; GACACTCTAGCGAGGAAGGCCCTGT
>probe:Drosophila_2:1627134_at:548:405; Interrogation_Position=1573; Antisense; GACGTCGGTTTGGACTACGGACACG
>probe:Drosophila_2:1627134_at:328:379; Interrogation_Position=1598; Antisense; GAACCGGCCATGGAGTAGGTCACTT
>probe:Drosophila_2:1627134_at:229:79; Interrogation_Position=1614; Antisense; AGGTCACTTCCTAAATGTCCACGAA
>probe:Drosophila_2:1627134_at:682:589; Interrogation_Position=1680; Antisense; TGGTCTCCAGGCGAACATGTTTATT
>probe:Drosophila_2:1627134_at:345:695; Interrogation_Position=1703; Antisense; TTTCCAATGAGCCTGGTTTCTACCA
>probe:Drosophila_2:1627134_at:372:725; Interrogation_Position=1760; Antisense; TTGTTCAAATTGTGCCAGGCCAGGT
>probe:Drosophila_2:1627134_at:509:81; Interrogation_Position=1781; Antisense; AGGTGGCACACAATTTCTCCAACCG
>probe:Drosophila_2:1627134_at:562:183; Interrogation_Position=1862; Antisense; AAAAGGAACTTCTATCGGATGCGGA
>probe:Drosophila_2:1627134_at:325:245; Interrogation_Position=1961; Antisense; AATTTACTCTGTCCTGGCTCAAAAA
>probe:Drosophila_2:1627134_at:91:375; Interrogation_Position=1987; Antisense; GAAGTTCAGCCCATTTAATTGCATT
>probe:Drosophila_2:1627134_at:516:243; Interrogation_Position=2042; Antisense; AATATTCTTTCCCATGCATACACTT
>probe:Drosophila_2:1627134_at:652:343; Interrogation_Position=2057; Antisense; GCATACACTTACTCTTTTCTCAAGA

Paste this into a BLAST search page for me
AGGGACAGGTTCTTGACACTCTAGCGACACTCTAGCGAGGAAGGCCCTGTGACGTCGGTTTGGACTACGGACACGGAACCGGCCATGGAGTAGGTCACTTAGGTCACTTCCTAAATGTCCACGAATGGTCTCCAGGCGAACATGTTTATTTTTCCAATGAGCCTGGTTTCTACCATTGTTCAAATTGTGCCAGGCCAGGTAGGTGGCACACAATTTCTCCAACCGAAAAGGAACTTCTATCGGATGCGGAAATTTACTCTGTCCTGGCTCAAAAAGAAGTTCAGCCCATTTAATTGCATTAATATTCTTTCCCATGCATACACTTGCATACACTTACTCTTTTCTCAAGA

Full Affymetrix probeset data:

Annotations for 1627134_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720