Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627135_at:

>probe:Drosophila_2:1627135_at:260:617; Interrogation_Position=3978; Antisense; TGCAAAACGCTTTCCCAATACTGTA
>probe:Drosophila_2:1627135_at:729:723; Interrogation_Position=4051; Antisense; TTGTAAATAGATACGCGGCTTAGTC
>probe:Drosophila_2:1627135_at:523:331; Interrogation_Position=4065; Antisense; GCGGCTTAGTCAAGTAAGATCCATT
>probe:Drosophila_2:1627135_at:396:47; Interrogation_Position=4083; Antisense; ATCCATTTTTTGTCTGTACTGTCGA
>probe:Drosophila_2:1627135_at:714:499; Interrogation_Position=4094; Antisense; GTCTGTACTGTCGAACCTCGCGTAG
>probe:Drosophila_2:1627135_at:502:281; Interrogation_Position=4110; Antisense; CTCGCGTAGCCTTAGCCTTGTAAAT
>probe:Drosophila_2:1627135_at:566:313; Interrogation_Position=4118; Antisense; GCCTTAGCCTTGTAAATCACCTTTG
>probe:Drosophila_2:1627135_at:194:233; Interrogation_Position=4143; Antisense; AATGCAATTTTTCCCACTCAAGTTA
>probe:Drosophila_2:1627135_at:555:141; Interrogation_Position=4158; Antisense; ACTCAAGTTAAAAATCGCAATGCGA
>probe:Drosophila_2:1627135_at:297:467; Interrogation_Position=4236; Antisense; GTTGGAAGCAAAACTCACAAATCAT
>probe:Drosophila_2:1627135_at:457:93; Interrogation_Position=4345; Antisense; AGTTGTAGCTGTATGATGGATTTAT
>probe:Drosophila_2:1627135_at:471:147; Interrogation_Position=4398; Antisense; ACTACTTCTAGTACGCTTAGGCTTA
>probe:Drosophila_2:1627135_at:118:487; Interrogation_Position=4408; Antisense; GTACGCTTAGGCTTAGACTAACAAA
>probe:Drosophila_2:1627135_at:216:171; Interrogation_Position=4460; Antisense; AACAATTTCCAGATAAGTCAGTAGT

Paste this into a BLAST search page for me
TGCAAAACGCTTTCCCAATACTGTATTGTAAATAGATACGCGGCTTAGTCGCGGCTTAGTCAAGTAAGATCCATTATCCATTTTTTGTCTGTACTGTCGAGTCTGTACTGTCGAACCTCGCGTAGCTCGCGTAGCCTTAGCCTTGTAAATGCCTTAGCCTTGTAAATCACCTTTGAATGCAATTTTTCCCACTCAAGTTAACTCAAGTTAAAAATCGCAATGCGAGTTGGAAGCAAAACTCACAAATCATAGTTGTAGCTGTATGATGGATTTATACTACTTCTAGTACGCTTAGGCTTAGTACGCTTAGGCTTAGACTAACAAAAACAATTTCCAGATAAGTCAGTAGT

Full Affymetrix probeset data:

Annotations for 1627135_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime