Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627136_at:

>probe:Drosophila_2:1627136_at:172:567; Interrogation_Position=8524; Antisense; GGCAGCCTTCGGAAAGAGTTTACTT
>probe:Drosophila_2:1627136_at:248:491; Interrogation_Position=8549; Antisense; GTAAGTTTGCGCACTCTTAGAGCTT
>probe:Drosophila_2:1627136_at:651:77; Interrogation_Position=8567; Antisense; AGAGCTTTTAGCACGGTCAACGAAT
>probe:Drosophila_2:1627136_at:560:665; Interrogation_Position=8601; Antisense; TACACCACAATTATAGCTCGACTCC
>probe:Drosophila_2:1627136_at:604:281; Interrogation_Position=8617; Antisense; CTCGACTCCATCAGCCGTTAAATAA
>probe:Drosophila_2:1627136_at:124:279; Interrogation_Position=8643; Antisense; CTATCCAAGAGTTCAGTCACGAGTT
>probe:Drosophila_2:1627136_at:587:279; Interrogation_Position=8678; Antisense; CTAAACCATATGCTAGACCTGCTTT
>probe:Drosophila_2:1627136_at:319:103; Interrogation_Position=8692; Antisense; AGACCTGCTTTATCATAGTACACAA
>probe:Drosophila_2:1627136_at:334:489; Interrogation_Position=8709; Antisense; GTACACAAACAGACGCACCAAGCAA
>probe:Drosophila_2:1627136_at:404:439; Interrogation_Position=8747; Antisense; GATGAATTTGGTTCGGTTCGTTCGG
>probe:Drosophila_2:1627136_at:221:61; Interrogation_Position=8787; Antisense; ATGTCAGTTTAGTTCACTCCACACT
>probe:Drosophila_2:1627136_at:210:93; Interrogation_Position=8797; Antisense; AGTTCACTCCACACTAGTAGTTGCA
>probe:Drosophila_2:1627136_at:139:365; Interrogation_Position=8855; Antisense; GAATATAGTTGTCAGCAGCGGAAAG
>probe:Drosophila_2:1627136_at:189:483; Interrogation_Position=8926; Antisense; GTATTTTAATGCCAACACGCCAGAG

Paste this into a BLAST search page for me
GGCAGCCTTCGGAAAGAGTTTACTTGTAAGTTTGCGCACTCTTAGAGCTTAGAGCTTTTAGCACGGTCAACGAATTACACCACAATTATAGCTCGACTCCCTCGACTCCATCAGCCGTTAAATAACTATCCAAGAGTTCAGTCACGAGTTCTAAACCATATGCTAGACCTGCTTTAGACCTGCTTTATCATAGTACACAAGTACACAAACAGACGCACCAAGCAAGATGAATTTGGTTCGGTTCGTTCGGATGTCAGTTTAGTTCACTCCACACTAGTTCACTCCACACTAGTAGTTGCAGAATATAGTTGTCAGCAGCGGAAAGGTATTTTAATGCCAACACGCCAGAG

Full Affymetrix probeset data:

Annotations for 1627136_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime