FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627138_at:

>probe:Drosophila_2:1627138_at:355:451; Interrogation_Position=156; Antisense; GATCGACAGCCGAATTGTCCTAACA
>probe:Drosophila_2:1627138_at:20:239; Interrogation_Position=216; Antisense; AATCACAGTCCGTGTGGGAACGCCG
>probe:Drosophila_2:1627138_at:34:493; Interrogation_Position=271; Antisense; GTAACAGCGCTGGTGGTTCATGAAA
>probe:Drosophila_2:1627138_at:158:459; Interrogation_Position=316; Antisense; GATATCGCCCTCTTATGGCTAGAGA
>probe:Drosophila_2:1627138_at:60:509; Interrogation_Position=346; Antisense; GTGCTTTCCGTACGAGTGACCAAAA
>probe:Drosophila_2:1627138_at:672:579; Interrogation_Position=377; Antisense; TGGCCACCAAAGAACCCTCTGAAAA
>probe:Drosophila_2:1627138_at:316:177; Interrogation_Position=433; Antisense; AAACTACTCGAGTCCTACGTCGTGA
>probe:Drosophila_2:1627138_at:375:633; Interrogation_Position=492; Antisense; TCCCCGGAGCATGTGCGCTGAAGAA
>probe:Drosophila_2:1627138_at:701:299; Interrogation_Position=526; Antisense; CCGGTTGGCGAGGAACTTCTTTGCG
>probe:Drosophila_2:1627138_at:314:643; Interrogation_Position=543; Antisense; TCTTTGCGCCTTTTACACCGAAAAT
>probe:Drosophila_2:1627138_at:696:597; Interrogation_Position=574; Antisense; TGTCCTGGCGATTATGGAGGTCCCT
>probe:Drosophila_2:1627138_at:149:257; Interrogation_Position=612; Antisense; CAAAGTGGTTGGCATCGCAGTGCAA
>probe:Drosophila_2:1627138_at:133:627; Interrogation_Position=662; Antisense; TGCCATCACTTTACACGAACGTCTT
>probe:Drosophila_2:1627138_at:573:195; Interrogation_Position=679; Antisense; AACGTCTTCCACTACCTGGAATGGA

Paste this into a BLAST search page for me
GATCGACAGCCGAATTGTCCTAACAAATCACAGTCCGTGTGGGAACGCCGGTAACAGCGCTGGTGGTTCATGAAAGATATCGCCCTCTTATGGCTAGAGAGTGCTTTCCGTACGAGTGACCAAAATGGCCACCAAAGAACCCTCTGAAAAAAACTACTCGAGTCCTACGTCGTGATCCCCGGAGCATGTGCGCTGAAGAACCGGTTGGCGAGGAACTTCTTTGCGTCTTTGCGCCTTTTACACCGAAAATTGTCCTGGCGATTATGGAGGTCCCTCAAAGTGGTTGGCATCGCAGTGCAATGCCATCACTTTACACGAACGTCTTAACGTCTTCCACTACCTGGAATGGA

Full Affymetrix probeset data:

Annotations for 1627138_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720