FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627139_at:

>probe:Drosophila_2:1627139_at:514:611; Interrogation_Position=1059; Antisense; TGACGGTGAACTCTGCAGTGGCATT
>probe:Drosophila_2:1627139_at:694:53; Interrogation_Position=562; Antisense; ATGCAGTCCCTGTATATCCTGAGAC
>probe:Drosophila_2:1627139_at:359:609; Interrogation_Position=581; Antisense; TGAGACGCCACTACGAGTTCTCGTA
>probe:Drosophila_2:1627139_at:504:555; Interrogation_Position=618; Antisense; GGACGACGATACCTATGTTAAGCTG
>probe:Drosophila_2:1627139_at:419:59; Interrogation_Position=646; Antisense; AGTCTAGTTAATACGCTGGTTTCCT
>probe:Drosophila_2:1627139_at:115:539; Interrogation_Position=663; Antisense; GGTTTCCTACGATCGCAAGTTGCTG
>probe:Drosophila_2:1627139_at:383:25; Interrogation_Position=704; Antisense; ATAGGGACCATGTGTTGCCTCAGCT
>probe:Drosophila_2:1627139_at:584:67; Interrogation_Position=782; Antisense; AGGAGTCTAGTTACTACCTTAGCAA
>probe:Drosophila_2:1627139_at:348:179; Interrogation_Position=807; Antisense; AAACTACCTGCCGTATGCACTGGGC
>probe:Drosophila_2:1627139_at:287:455; Interrogation_Position=836; Antisense; GATACGTTCTGTCCCGAAGTCTGTG
>probe:Drosophila_2:1627139_at:607:725; Interrogation_Position=869; Antisense; TTGTCAATAACTCCCAACTGCTATC
>probe:Drosophila_2:1627139_at:680:193; Interrogation_Position=884; Antisense; AACTGCTATCGCACTATGGGTCCGA
>probe:Drosophila_2:1627139_at:364:41; Interrogation_Position=953; Antisense; ATCGGTGGCACGATCCCAGATTCGA
>probe:Drosophila_2:1627139_at:466:221; Interrogation_Position=997; Antisense; AAGTGTCGGTCCTATCACATGGTGC

Paste this into a BLAST search page for me
TGACGGTGAACTCTGCAGTGGCATTATGCAGTCCCTGTATATCCTGAGACTGAGACGCCACTACGAGTTCTCGTAGGACGACGATACCTATGTTAAGCTGAGTCTAGTTAATACGCTGGTTTCCTGGTTTCCTACGATCGCAAGTTGCTGATAGGGACCATGTGTTGCCTCAGCTAGGAGTCTAGTTACTACCTTAGCAAAAACTACCTGCCGTATGCACTGGGCGATACGTTCTGTCCCGAAGTCTGTGTTGTCAATAACTCCCAACTGCTATCAACTGCTATCGCACTATGGGTCCGAATCGGTGGCACGATCCCAGATTCGAAAGTGTCGGTCCTATCACATGGTGC

Full Affymetrix probeset data:

Annotations for 1627139_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720