Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627141_at:

>probe:Drosophila_2:1627141_at:159:219; Interrogation_Position=1108; Antisense; AAGTCGTCGAGCAACCCGAAGTGCG
>probe:Drosophila_2:1627141_at:109:221; Interrogation_Position=1126; Antisense; AAGTGCGTCTTCACCGAAGGCGGTG
>probe:Drosophila_2:1627141_at:666:625; Interrogation_Position=1189; Antisense; TGCCGCAAGCACATTCTGGAGGATA
>probe:Drosophila_2:1627141_at:514:31; Interrogation_Position=1211; Antisense; ATAAGCGCCAGGTGCTGTTCCGAGC
>probe:Drosophila_2:1627141_at:416:415; Interrogation_Position=1270; Antisense; GAGCCAGTGGCTAGCATTCTCGAAG
>probe:Drosophila_2:1627141_at:515:7; Interrogation_Position=1285; Antisense; ATTCTCGAAGACTCCAGTTGCGTAC
>probe:Drosophila_2:1627141_at:221:95; Interrogation_Position=1300; Antisense; AGTTGCGTACTGCACCTGACCGTGG
>probe:Drosophila_2:1627141_at:406:87; Interrogation_Position=1388; Antisense; AGTCCACCAGCTTGATTAGCACCAT
>probe:Drosophila_2:1627141_at:626:73; Interrogation_Position=1427; Antisense; AGGACCCCTCGGATAAGCTGTATAC
>probe:Drosophila_2:1627141_at:34:475; Interrogation_Position=1446; Antisense; GTATACGAGTCAAGCCCTCAACGTG
>probe:Drosophila_2:1627141_at:219:513; Interrogation_Position=1468; Antisense; GTGACCACCGCACATGGCGAAGACA
>probe:Drosophila_2:1627141_at:88:431; Interrogation_Position=1516; Antisense; GAGTACGCCCCAAACAGATCTTAAA
>probe:Drosophila_2:1627141_at:651:495; Interrogation_Position=1620; Antisense; GTCAGTTGGTTTTGTACTCAGCCAT
>probe:Drosophila_2:1627141_at:579:483; Interrogation_Position=1646; Antisense; GTAGTTTTTGGTGCATTCGGGTGTA

Paste this into a BLAST search page for me
AAGTCGTCGAGCAACCCGAAGTGCGAAGTGCGTCTTCACCGAAGGCGGTGTGCCGCAAGCACATTCTGGAGGATAATAAGCGCCAGGTGCTGTTCCGAGCGAGCCAGTGGCTAGCATTCTCGAAGATTCTCGAAGACTCCAGTTGCGTACAGTTGCGTACTGCACCTGACCGTGGAGTCCACCAGCTTGATTAGCACCATAGGACCCCTCGGATAAGCTGTATACGTATACGAGTCAAGCCCTCAACGTGGTGACCACCGCACATGGCGAAGACAGAGTACGCCCCAAACAGATCTTAAAGTCAGTTGGTTTTGTACTCAGCCATGTAGTTTTTGGTGCATTCGGGTGTA

Full Affymetrix probeset data:

Annotations for 1627141_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime