FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627142_at:

>probe:Drosophila_2:1627142_at:215:209; Interrogation_Position=2497; Antisense; AAGCATGTGCTTATCGGCACTGCCA
>probe:Drosophila_2:1627142_at:440:259; Interrogation_Position=2514; Antisense; CACTGCCAGTGGTTCCATTGTGGAA
>probe:Drosophila_2:1627142_at:616:233; Interrogation_Position=2538; Antisense; AATGCCGTGGCATTTGCTGGATCCC
>probe:Drosophila_2:1627142_at:650:613; Interrogation_Position=2595; Antisense; TGAAGAAGGAGCCATCCCCTACATA
>probe:Drosophila_2:1627142_at:317:627; Interrogation_Position=2627; Antisense; TGCCTTTGCCAACAGAGAGCCACAT
>probe:Drosophila_2:1627142_at:671:539; Interrogation_Position=2667; Antisense; GGTTGCCCGTCTGCGTAATATTTAC
>probe:Drosophila_2:1627142_at:720:99; Interrogation_Position=2711; Antisense; AGAGTACCTGTCTAGTCGTTGCTAC
>probe:Drosophila_2:1627142_at:484:569; Interrogation_Position=2737; Antisense; GGCTTAGATTTGTTCGTTACGCGCG
>probe:Drosophila_2:1627142_at:147:521; Interrogation_Position=2761; Antisense; GTGGCGCCATCAAAGACGTTCGACT
>probe:Drosophila_2:1627142_at:16:19; Interrogation_Position=2815; Antisense; ATTTCCATAGTGCTAGTCGCGCTCA
>probe:Drosophila_2:1627142_at:395:339; Interrogation_Position=2835; Antisense; GCTCACATCAGGCTCGTTGATTGTT
>probe:Drosophila_2:1627142_at:475:5; Interrogation_Position=2854; Antisense; ATTGTTAAGCATTTAGCGTCGCGTA
>probe:Drosophila_2:1627142_at:489:329; Interrogation_Position=2869; Antisense; GCGTCGCGTAAATTGCTCAAGCAGG
>probe:Drosophila_2:1627142_at:262:457; Interrogation_Position=3039; Antisense; GATAGCTGCATTACATCCCACAATG

Paste this into a BLAST search page for me
AAGCATGTGCTTATCGGCACTGCCACACTGCCAGTGGTTCCATTGTGGAAAATGCCGTGGCATTTGCTGGATCCCTGAAGAAGGAGCCATCCCCTACATATGCCTTTGCCAACAGAGAGCCACATGGTTGCCCGTCTGCGTAATATTTACAGAGTACCTGTCTAGTCGTTGCTACGGCTTAGATTTGTTCGTTACGCGCGGTGGCGCCATCAAAGACGTTCGACTATTTCCATAGTGCTAGTCGCGCTCAGCTCACATCAGGCTCGTTGATTGTTATTGTTAAGCATTTAGCGTCGCGTAGCGTCGCGTAAATTGCTCAAGCAGGGATAGCTGCATTACATCCCACAATG

Full Affymetrix probeset data:

Annotations for 1627142_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720