FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627144_at:

>probe:Drosophila_2:1627144_at:674:83; Interrogation_Position=1041; Antisense; AGTGGATGGGCCTTCATTTGCTCTA
>probe:Drosophila_2:1627144_at:545:645; Interrogation_Position=1054; Antisense; TCATTTGCTCTATATCCGTCATGGG
>probe:Drosophila_2:1627144_at:152:305; Interrogation_Position=1069; Antisense; CCGTCATGGGAGTCGTTCTGCTGGA
>probe:Drosophila_2:1627144_at:481:333; Interrogation_Position=1088; Antisense; GCTGGACCCCACAGATGATGCTGAT
>probe:Drosophila_2:1627144_at:619:275; Interrogation_Position=1145; Antisense; CTTTACGAATTCCATCTACACCAAT
>probe:Drosophila_2:1627144_at:320:249; Interrogation_Position=1166; Antisense; CAATCCCAGATACCGCAGGCATATG
>probe:Drosophila_2:1627144_at:692:171; Interrogation_Position=1191; Antisense; AAAGTTGTCTTACCTTGGCTGCAGC
>probe:Drosophila_2:1627144_at:595:351; Interrogation_Position=1211; Antisense; GCAGCATCGTGGTGCCTTGGAGTAA
>probe:Drosophila_2:1627144_at:471:183; Interrogation_Position=734; Antisense; AAAATCCGACGAGTTCAATGCCCTC
>probe:Drosophila_2:1627144_at:89:149; Interrogation_Position=829; Antisense; ACTTTGTGGATCTTCAACTGCCGAA
>probe:Drosophila_2:1627144_at:527:15; Interrogation_Position=880; Antisense; ATTATTTCTTGCTTTCATCGACCAG
>probe:Drosophila_2:1627144_at:595:161; Interrogation_Position=924; Antisense; AAATTCGACTATTTCGTCTGGTTCT
>probe:Drosophila_2:1627144_at:674:639; Interrogation_Position=940; Antisense; TCTGGTTCTACCACTCAGAGTTGGT
>probe:Drosophila_2:1627144_at:139:533; Interrogation_Position=962; Antisense; GGTGAAACACCTCAAACTTCTGAAC

Paste this into a BLAST search page for me
AGTGGATGGGCCTTCATTTGCTCTATCATTTGCTCTATATCCGTCATGGGCCGTCATGGGAGTCGTTCTGCTGGAGCTGGACCCCACAGATGATGCTGATCTTTACGAATTCCATCTACACCAATCAATCCCAGATACCGCAGGCATATGAAAGTTGTCTTACCTTGGCTGCAGCGCAGCATCGTGGTGCCTTGGAGTAAAAAATCCGACGAGTTCAATGCCCTCACTTTGTGGATCTTCAACTGCCGAAATTATTTCTTGCTTTCATCGACCAGAAATTCGACTATTTCGTCTGGTTCTTCTGGTTCTACCACTCAGAGTTGGTGGTGAAACACCTCAAACTTCTGAAC

Full Affymetrix probeset data:

Annotations for 1627144_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720