FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627147_at:

>probe:Drosophila_2:1627147_at:150:667; Interrogation_Position=462; Antisense; TACAGCATCAAGAGCCCATTCGACG
>probe:Drosophila_2:1627147_at:478:273; Interrogation_Position=478; Antisense; CATTCGACGCCATGCTGCAAGTATA
>probe:Drosophila_2:1627147_at:453:377; Interrogation_Position=524; Antisense; GAAGCTAGCAATGACCACGCTGCGT
>probe:Drosophila_2:1627147_at:639:317; Interrogation_Position=555; Antisense; GCCGGCACCCACAAGCTAATGGATT
>probe:Drosophila_2:1627147_at:725:541; Interrogation_Position=575; Antisense; GGATTTGCTCTCGTCCAAGGAGTAC
>probe:Drosophila_2:1627147_at:521:549; Interrogation_Position=593; Antisense; GGAGTACCTCTCCAACCAAATAGAG
>probe:Drosophila_2:1627147_at:701:689; Interrogation_Position=622; Antisense; TATTGTACAACTCCACAGAGCCCTG
>probe:Drosophila_2:1627147_at:314:551; Interrogation_Position=677; Antisense; GGAGATCTTCATGCCTGATCAACTG
>probe:Drosophila_2:1627147_at:111:123; Interrogation_Position=772; Antisense; AGCGAGATGCGGTAACTGCTCTGAA
>probe:Drosophila_2:1627147_at:699:143; Interrogation_Position=786; Antisense; ACTGCTCTGAAGGAGGCTGCCGACA
>probe:Drosophila_2:1627147_at:290:125; Interrogation_Position=830; Antisense; AGCCCTGCAGCTACGGTACTTGCAA
>probe:Drosophila_2:1627147_at:686:149; Interrogation_Position=847; Antisense; ACTTGCAAACACTGAACTCCATCTG
>probe:Drosophila_2:1627147_at:116:39; Interrogation_Position=867; Antisense; ATCTGCAATGATGACACCCGGTCCT
>probe:Drosophila_2:1627147_at:603:669; Interrogation_Position=891; Antisense; TACGTCTTTCCTTTTCCTGTAGACA

Paste this into a BLAST search page for me
TACAGCATCAAGAGCCCATTCGACGCATTCGACGCCATGCTGCAAGTATAGAAGCTAGCAATGACCACGCTGCGTGCCGGCACCCACAAGCTAATGGATTGGATTTGCTCTCGTCCAAGGAGTACGGAGTACCTCTCCAACCAAATAGAGTATTGTACAACTCCACAGAGCCCTGGGAGATCTTCATGCCTGATCAACTGAGCGAGATGCGGTAACTGCTCTGAAACTGCTCTGAAGGAGGCTGCCGACAAGCCCTGCAGCTACGGTACTTGCAAACTTGCAAACACTGAACTCCATCTGATCTGCAATGATGACACCCGGTCCTTACGTCTTTCCTTTTCCTGTAGACA

Full Affymetrix probeset data:

Annotations for 1627147_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720