FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627148_at:

>probe:Drosophila_2:1627148_at:586:555; Interrogation_Position=1561; Antisense; GGACGCCCAAGAGTCGCTGGCATAT
>probe:Drosophila_2:1627148_at:61:17; Interrogation_Position=1605; Antisense; ATTTATGTCACAACCGGATCAGCGA
>probe:Drosophila_2:1627148_at:567:445; Interrogation_Position=1651; Antisense; GATGCTTGAGGATCGCGGCAACACT
>probe:Drosophila_2:1627148_at:685:565; Interrogation_Position=1667; Antisense; GGCAACACTGCGGTGTACTTACTTT
>probe:Drosophila_2:1627148_at:409:481; Interrogation_Position=1681; Antisense; GTACTTACTTTACACCTACACACGT
>probe:Drosophila_2:1627148_at:132:157; Interrogation_Position=1700; Antisense; ACACGTATTTGCTCCATTGCACGAA
>probe:Drosophila_2:1627148_at:701:323; Interrogation_Position=1731; Antisense; GCGAAGATTTCACCAATTTACCCGA
>probe:Drosophila_2:1627148_at:403:585; Interrogation_Position=1799; Antisense; TGGAAGCTGGCTAAGACTCTACTGA
>probe:Drosophila_2:1627148_at:253:391; Interrogation_Position=1822; Antisense; GAAACTCCACGACATACTCATCAAG
>probe:Drosophila_2:1627148_at:569:225; Interrogation_Position=1853; Antisense; AAGGAACTTTTCCTGCACTTCCTGT
>probe:Drosophila_2:1627148_at:139:149; Interrogation_Position=1869; Antisense; ACTTCCTGTGCGAGTTTTGCTTCGA
>probe:Drosophila_2:1627148_at:61:515; Interrogation_Position=1904; Antisense; GTGTTCACCGAATTCTATGACTCTT
>probe:Drosophila_2:1627148_at:411:643; Interrogation_Position=1987; Antisense; TCTATTGTGCGAGGCAACTGCGGCT
>probe:Drosophila_2:1627148_at:35:335; Interrogation_Position=2009; Antisense; GCTGTGTTGCGCCAATGCTTTTATA

Paste this into a BLAST search page for me
GGACGCCCAAGAGTCGCTGGCATATATTTATGTCACAACCGGATCAGCGAGATGCTTGAGGATCGCGGCAACACTGGCAACACTGCGGTGTACTTACTTTGTACTTACTTTACACCTACACACGTACACGTATTTGCTCCATTGCACGAAGCGAAGATTTCACCAATTTACCCGATGGAAGCTGGCTAAGACTCTACTGAGAAACTCCACGACATACTCATCAAGAAGGAACTTTTCCTGCACTTCCTGTACTTCCTGTGCGAGTTTTGCTTCGAGTGTTCACCGAATTCTATGACTCTTTCTATTGTGCGAGGCAACTGCGGCTGCTGTGTTGCGCCAATGCTTTTATA

Full Affymetrix probeset data:

Annotations for 1627148_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720