Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627150_at:

>probe:Drosophila_2:1627150_at:506:353; Interrogation_Position=2465; Antisense; GCACGGATGCAAAGCCCCAAGATGT
>probe:Drosophila_2:1627150_at:115:251; Interrogation_Position=2482; Antisense; CAAGATGTGGCGACTATTCCGGCCG
>probe:Drosophila_2:1627150_at:726:687; Interrogation_Position=2496; Antisense; TATTCCGGCCGGACACTGTGAGACG
>probe:Drosophila_2:1627150_at:419:423; Interrogation_Position=2515; Antisense; GAGACGGACGTTACACACACGGATA
>probe:Drosophila_2:1627150_at:380:159; Interrogation_Position=2561; Antisense; ACAACAGACAGAAGACGCTTGCTCT
>probe:Drosophila_2:1627150_at:301:409; Interrogation_Position=2574; Antisense; GACGCTTGCTCTGAATAGATGGTTA
>probe:Drosophila_2:1627150_at:231:403; Interrogation_Position=2606; Antisense; GACTTATAAGGAACGTCGACAGCGA
>probe:Drosophila_2:1627150_at:16:401; Interrogation_Position=2623; Antisense; GACAGCGAGGGTTCGTTCGCGTCAC
>probe:Drosophila_2:1627150_at:65:635; Interrogation_Position=2639; Antisense; TCGCGTCACTTGCTTTTTACTACAT
>probe:Drosophila_2:1627150_at:196:387; Interrogation_Position=2706; Antisense; GAACACCACACTATACAAACACCTA
>probe:Drosophila_2:1627150_at:634:391; Interrogation_Position=2792; Antisense; GAAACCCGACAAGAAGATGGCTGAA
>probe:Drosophila_2:1627150_at:673:607; Interrogation_Position=2830; Antisense; TGAAATTTTCCAACCAGCATACCCG
>probe:Drosophila_2:1627150_at:28:115; Interrogation_Position=2845; Antisense; AGCATACCCGTGAGACCCAGAGGTC
>probe:Drosophila_2:1627150_at:553:491; Interrogation_Position=2907; Antisense; GTAAATCCTAGTCTCGTAGCAATAT

Paste this into a BLAST search page for me
GCACGGATGCAAAGCCCCAAGATGTCAAGATGTGGCGACTATTCCGGCCGTATTCCGGCCGGACACTGTGAGACGGAGACGGACGTTACACACACGGATAACAACAGACAGAAGACGCTTGCTCTGACGCTTGCTCTGAATAGATGGTTAGACTTATAAGGAACGTCGACAGCGAGACAGCGAGGGTTCGTTCGCGTCACTCGCGTCACTTGCTTTTTACTACATGAACACCACACTATACAAACACCTAGAAACCCGACAAGAAGATGGCTGAATGAAATTTTCCAACCAGCATACCCGAGCATACCCGTGAGACCCAGAGGTCGTAAATCCTAGTCTCGTAGCAATAT

Full Affymetrix probeset data:

Annotations for 1627150_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime