Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627151_at:

>probe:Drosophila_2:1627151_at:499:549; Interrogation_Position=1533; Antisense; GGAGTTGACTTGGAACCCACACACA
>probe:Drosophila_2:1627151_at:101:159; Interrogation_Position=1551; Antisense; ACACACATACAATACACACCCATAT
>probe:Drosophila_2:1627151_at:212:249; Interrogation_Position=1602; Antisense; AATTGTATCGAGCAGCTAGGCGGAC
>probe:Drosophila_2:1627151_at:727:267; Interrogation_Position=1617; Antisense; CTAGGCGGACATTCAGGCAGCAGAC
>probe:Drosophila_2:1627151_at:381:117; Interrogation_Position=1653; Antisense; AGCTCCTTCGCATATACACTTAGAT
>probe:Drosophila_2:1627151_at:20:359; Interrogation_Position=1682; Antisense; GCAAAAGTCTTGCAACACAGTTGAA
>probe:Drosophila_2:1627151_at:539:175; Interrogation_Position=1754; Antisense; AAACGAGCTCTCAACCGAAAGGATT
>probe:Drosophila_2:1627151_at:223:19; Interrogation_Position=1799; Antisense; ATTTCTTAGCACTCACTAGCGTTTT
>probe:Drosophila_2:1627151_at:574:621; Interrogation_Position=1874; Antisense; TGCTGTCAGCTTCTCGCCTAAAGAA
>probe:Drosophila_2:1627151_at:536:5; Interrogation_Position=1902; Antisense; ATTGCGTACACACACGTATTTCGAA
>probe:Drosophila_2:1627151_at:555:49; Interrogation_Position=1927; Antisense; ATGTATTTACCCACACAAGGCCAAC
>probe:Drosophila_2:1627151_at:615:577; Interrogation_Position=1961; Antisense; GGCCCCTTGGCATTAAGTCTAGATC
>probe:Drosophila_2:1627151_at:41:639; Interrogation_Position=1984; Antisense; TCGTGCGATCGCAACTAGAGCTACG
>probe:Drosophila_2:1627151_at:630:263; Interrogation_Position=2011; Antisense; CAGCTCAGTCCTGGGCAACATATGA

Paste this into a BLAST search page for me
GGAGTTGACTTGGAACCCACACACAACACACATACAATACACACCCATATAATTGTATCGAGCAGCTAGGCGGACCTAGGCGGACATTCAGGCAGCAGACAGCTCCTTCGCATATACACTTAGATGCAAAAGTCTTGCAACACAGTTGAAAAACGAGCTCTCAACCGAAAGGATTATTTCTTAGCACTCACTAGCGTTTTTGCTGTCAGCTTCTCGCCTAAAGAAATTGCGTACACACACGTATTTCGAAATGTATTTACCCACACAAGGCCAACGGCCCCTTGGCATTAAGTCTAGATCTCGTGCGATCGCAACTAGAGCTACGCAGCTCAGTCCTGGGCAACATATGA

Full Affymetrix probeset data:

Annotations for 1627151_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime