FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627153_at:

>probe:Drosophila_2:1627153_at:93:581; Interrogation_Position=165; Antisense; TGGCTTTAACTACTTCCACTACGGA
>probe:Drosophila_2:1627153_at:401:237; Interrogation_Position=239; Antisense; AATCGGCCATTTCCTGGATCCAACG
>probe:Drosophila_2:1627153_at:484:59; Interrogation_Position=284; Antisense; ATGTTCCTTCCATCCGGGAGATTCA
>probe:Drosophila_2:1627153_at:200:551; Interrogation_Position=300; Antisense; GGAGATTCAGCAGATCCTGGTGGCC
>probe:Drosophila_2:1627153_at:593:137; Interrogation_Position=332; Antisense; ACAAGGGTCCAGAGTTCGTGGGCTC
>probe:Drosophila_2:1627153_at:406:135; Interrogation_Position=373; Antisense; ACGCTCGAGGAGTTCTACGTGATCG
>probe:Drosophila_2:1627153_at:89:671; Interrogation_Position=388; Antisense; TACGTGATCGATGTGCTGCACCAGG
>probe:Drosophila_2:1627153_at:155:129; Interrogation_Position=407; Antisense; ACCAGGTGCCGTGCAAGATTCTTCA
>probe:Drosophila_2:1627153_at:312:463; Interrogation_Position=423; Antisense; GATTCTTCACGCCAAGGAGCTTAGC
>probe:Drosophila_2:1627153_at:267:97; Interrogation_Position=455; Antisense; AGATCCTCGGCGAGCTTCGGAGCTA
>probe:Drosophila_2:1627153_at:117:421; Interrogation_Position=484; Antisense; GAGAAGTACCAAGGCTTCGTCGCCA
>probe:Drosophila_2:1627153_at:273:689; Interrogation_Position=540; Antisense; TATTACCGGCTACCATTGCAGTGCA
>probe:Drosophila_2:1627153_at:700:347; Interrogation_Position=582; Antisense; GCAGGTGGTGGATCCGCATTTCGTA
>probe:Drosophila_2:1627153_at:32:355; Interrogation_Position=627; Antisense; GCACTTAATCGATCTGGGCTACGTT

Paste this into a BLAST search page for me
TGGCTTTAACTACTTCCACTACGGAAATCGGCCATTTCCTGGATCCAACGATGTTCCTTCCATCCGGGAGATTCAGGAGATTCAGCAGATCCTGGTGGCCACAAGGGTCCAGAGTTCGTGGGCTCACGCTCGAGGAGTTCTACGTGATCGTACGTGATCGATGTGCTGCACCAGGACCAGGTGCCGTGCAAGATTCTTCAGATTCTTCACGCCAAGGAGCTTAGCAGATCCTCGGCGAGCTTCGGAGCTAGAGAAGTACCAAGGCTTCGTCGCCATATTACCGGCTACCATTGCAGTGCAGCAGGTGGTGGATCCGCATTTCGTAGCACTTAATCGATCTGGGCTACGTT

Full Affymetrix probeset data:

Annotations for 1627153_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720