FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627154_at:

>probe:Drosophila_2:1627154_at:492:71; Interrogation_Position=395; Antisense; AGGCTTGTCGATGGGAGCACTTCAA
>probe:Drosophila_2:1627154_at:116:409; Interrogation_Position=420; Antisense; GACGTTGATGTTCCTACGATCTGTT
>probe:Drosophila_2:1627154_at:181:677; Interrogation_Position=446; Antisense; TAGAACCACGACCAGGCTATCAACA
>probe:Drosophila_2:1627154_at:32:341; Interrogation_Position=461; Antisense; GCTATCAACAAGGTGCTCCGGGCAA
>probe:Drosophila_2:1627154_at:161:379; Interrogation_Position=498; Antisense; GAAGCTGGACATGTGCTACCCGGAT
>probe:Drosophila_2:1627154_at:570:173; Interrogation_Position=534; Antisense; AAAGCAGAGCCAATCCTCGATAGAA
>probe:Drosophila_2:1627154_at:590:53; Interrogation_Position=587; Antisense; ATGCAGAAATCTGTCAGCCTCCGAA
>probe:Drosophila_2:1627154_at:516:623; Interrogation_Position=648; Antisense; TGCGCCGTCTTCCAAATTCGTTGAT
>probe:Drosophila_2:1627154_at:658:235; Interrogation_Position=676; Antisense; AATCGAACTGTCGAAGCTCCAGCTG
>probe:Drosophila_2:1627154_at:287:251; Interrogation_Position=739; Antisense; CAATGGGACGCATTTGGCGAACTAA
>probe:Drosophila_2:1627154_at:17:385; Interrogation_Position=757; Antisense; GAACTAATCGCCAGTGAATTCCGTA
>probe:Drosophila_2:1627154_at:312:363; Interrogation_Position=772; Antisense; GAATTCCGTAACCTGAACTCTGAAG
>probe:Drosophila_2:1627154_at:264:373; Interrogation_Position=793; Antisense; GAAGTTTCGCGCAAGAGGCTGAAGC
>probe:Drosophila_2:1627154_at:338:29; Interrogation_Position=900; Antisense; ATACAGCGGACACCGTTTTAGGTAT

Paste this into a BLAST search page for me
AGGCTTGTCGATGGGAGCACTTCAAGACGTTGATGTTCCTACGATCTGTTTAGAACCACGACCAGGCTATCAACAGCTATCAACAAGGTGCTCCGGGCAAGAAGCTGGACATGTGCTACCCGGATAAAGCAGAGCCAATCCTCGATAGAAATGCAGAAATCTGTCAGCCTCCGAATGCGCCGTCTTCCAAATTCGTTGATAATCGAACTGTCGAAGCTCCAGCTGCAATGGGACGCATTTGGCGAACTAAGAACTAATCGCCAGTGAATTCCGTAGAATTCCGTAACCTGAACTCTGAAGGAAGTTTCGCGCAAGAGGCTGAAGCATACAGCGGACACCGTTTTAGGTAT

Full Affymetrix probeset data:

Annotations for 1627154_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720