FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627156_at:

>probe:Drosophila_2:1627156_at:272:397; Interrogation_Position=184; Antisense; GACAGGAACTGCACTTCTGCGGATT
>probe:Drosophila_2:1627156_at:251:139; Interrogation_Position=211; Antisense; ACGTCCATCCGCCAAGTGATTGATA
>probe:Drosophila_2:1627156_at:679:215; Interrogation_Position=244; Antisense; AAGATTATCCATGGCCAATTCGGCT
>probe:Drosophila_2:1627156_at:572:57; Interrogation_Position=287; Antisense; ATGATATTGCGCTACTTCGATTGGC
>probe:Drosophila_2:1627156_at:704:221; Interrogation_Position=316; Antisense; AAGGTGTCGATCTCAGACTACGTCA
>probe:Drosophila_2:1627156_at:26:405; Interrogation_Position=331; Antisense; GACTACGTCAGACCAATTTGCCTGT
>probe:Drosophila_2:1627156_at:263:527; Interrogation_Position=372; Antisense; GGGACGTAGCGTTCAACATTTCACT
>probe:Drosophila_2:1627156_at:216:201; Interrogation_Position=428; Antisense; AACCCAGCACCATTTTACAGACAGT
>probe:Drosophila_2:1627156_at:349:111; Interrogation_Position=500; Antisense; AGAATATCGATGCATCCCAGCTATG
>probe:Drosophila_2:1627156_at:41:439; Interrogation_Position=566; Antisense; GAGGCCCGCTGAGCTTAACGTTGAA
>probe:Drosophila_2:1627156_at:389:663; Interrogation_Position=618; Antisense; TAAATCTCGGGCTTTTCTCATCGGC
>probe:Drosophila_2:1627156_at:403:279; Interrogation_Position=634; Antisense; CTCATCGGCATTGTCAGCTATGGTA
>probe:Drosophila_2:1627156_at:546:639; Interrogation_Position=720; Antisense; TATTTGGATGGCTCTTCAGTCACTG
>probe:Drosophila_2:1627156_at:508:343; Interrogation_Position=753; Antisense; GCTTCATCTTTGTCATTTGCTGGTC

Paste this into a BLAST search page for me
GACAGGAACTGCACTTCTGCGGATTACGTCCATCCGCCAAGTGATTGATAAAGATTATCCATGGCCAATTCGGCTATGATATTGCGCTACTTCGATTGGCAAGGTGTCGATCTCAGACTACGTCAGACTACGTCAGACCAATTTGCCTGTGGGACGTAGCGTTCAACATTTCACTAACCCAGCACCATTTTACAGACAGTAGAATATCGATGCATCCCAGCTATGGAGGCCCGCTGAGCTTAACGTTGAATAAATCTCGGGCTTTTCTCATCGGCCTCATCGGCATTGTCAGCTATGGTATATTTGGATGGCTCTTCAGTCACTGGCTTCATCTTTGTCATTTGCTGGTC

Full Affymetrix probeset data:

Annotations for 1627156_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720