FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627159_at:

>probe:Drosophila_2:1627159_at:523:457; Interrogation_Position=109; Antisense; GATATGCAGCATGTTGCTCCACTGG
>probe:Drosophila_2:1627159_at:60:409; Interrogation_Position=153; Antisense; GACGTCGGCAGACCAAGTCTCTAAC
>probe:Drosophila_2:1627159_at:710:217; Interrogation_Position=167; Antisense; AAGTCTCTAACAGCATACGCGGTCC
>probe:Drosophila_2:1627159_at:314:261; Interrogation_Position=191; Antisense; CACGCCATCTCCTGAGCAAATTGTT
>probe:Drosophila_2:1627159_at:374:421; Interrogation_Position=204; Antisense; GAGCAAATTGTTCCAGCCCAAGACC
>probe:Drosophila_2:1627159_at:371:309; Interrogation_Position=221; Antisense; CCAAGACCGTGGTGGTGCAGCCAGT
>probe:Drosophila_2:1627159_at:180:421; Interrogation_Position=253; Antisense; GAGCAGGTGGCTCCAAGACAGTACC
>probe:Drosophila_2:1627159_at:101:629; Interrogation_Position=264; Antisense; TCCAAGACAGTACCCCGGATACGCA
>probe:Drosophila_2:1627159_at:604:123; Interrogation_Position=290; Antisense; AGCCCTATCCGTACTACAACCAGGG
>probe:Drosophila_2:1627159_at:291:159; Interrogation_Position=305; Antisense; ACAACCAGGGCCGACGCTACTGGTA
>probe:Drosophila_2:1627159_at:291:609; Interrogation_Position=38; Antisense; TGAGCAGCCTCACCATTGCGATGGT
>probe:Drosophila_2:1627159_at:184:9; Interrogation_Position=52; Antisense; ATTGCGATGGTTTTGGCATTTCCTG
>probe:Drosophila_2:1627159_at:89:585; Interrogation_Position=65; Antisense; TGGCATTTCCTGATAACGACGATAA
>probe:Drosophila_2:1627159_at:640:179; Interrogation_Position=88; Antisense; AAAAATGTTCTTGTGCCAGCTGATA

Paste this into a BLAST search page for me
GATATGCAGCATGTTGCTCCACTGGGACGTCGGCAGACCAAGTCTCTAACAAGTCTCTAACAGCATACGCGGTCCCACGCCATCTCCTGAGCAAATTGTTGAGCAAATTGTTCCAGCCCAAGACCCCAAGACCGTGGTGGTGCAGCCAGTGAGCAGGTGGCTCCAAGACAGTACCTCCAAGACAGTACCCCGGATACGCAAGCCCTATCCGTACTACAACCAGGGACAACCAGGGCCGACGCTACTGGTATGAGCAGCCTCACCATTGCGATGGTATTGCGATGGTTTTGGCATTTCCTGTGGCATTTCCTGATAACGACGATAAAAAAATGTTCTTGTGCCAGCTGATA

Full Affymetrix probeset data:

Annotations for 1627159_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720