FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627160_at:

>probe:Drosophila_2:1627160_at:385:625; Interrogation_Position=125; Antisense; TGCCCTTGGCCTATTCCCGTTTGAT
>probe:Drosophila_2:1627160_at:322:689; Interrogation_Position=136; Antisense; TATTCCCGTTTGATTGCCCCGGCAG
>probe:Drosophila_2:1627160_at:709:187; Interrogation_Position=14; Antisense; AACAGCTGATCTTTGCCTGTTTGCT
>probe:Drosophila_2:1627160_at:210:345; Interrogation_Position=171; Antisense; GCATCTTTACCACAGCGTGGAGACC
>probe:Drosophila_2:1627160_at:71:155; Interrogation_Position=182; Antisense; ACAGCGTGGAGACCCCGAACTCCTT
>probe:Drosophila_2:1627160_at:477:145; Interrogation_Position=200; Antisense; ACTCCTTCCAGCAGCAATATCGCAG
>probe:Drosophila_2:1627160_at:415:243; Interrogation_Position=215; Antisense; AATATCGCAGCGACTACAAGCCCCT
>probe:Drosophila_2:1627160_at:502:157; Interrogation_Position=230; Antisense; ACAAGCCCCTGACCTATGAGTACAT
>probe:Drosophila_2:1627160_at:284:299; Interrogation_Position=236; Antisense; CCCTGACCTATGAGTACATCTACTA
>probe:Drosophila_2:1627160_at:643:305; Interrogation_Position=29; Antisense; CCTGTTTGCTTGCTCTGGCTTTGGG
>probe:Drosophila_2:1627160_at:280:531; Interrogation_Position=60; Antisense; GGTGTATTACTATACCCCCAGCTAT
>probe:Drosophila_2:1627160_at:583:297; Interrogation_Position=76; Antisense; CCCAGCTATGGGTACTACCCCAGTA
>probe:Drosophila_2:1627160_at:612:667; Interrogation_Position=88; Antisense; TACTACCCCAGTACCTTTGCCAGGT
>probe:Drosophila_2:1627160_at:157:91; Interrogation_Position=97; Antisense; AGTACCTTTGCCAGGTCCTCGGCTG

Paste this into a BLAST search page for me
TGCCCTTGGCCTATTCCCGTTTGATTATTCCCGTTTGATTGCCCCGGCAGAACAGCTGATCTTTGCCTGTTTGCTGCATCTTTACCACAGCGTGGAGACCACAGCGTGGAGACCCCGAACTCCTTACTCCTTCCAGCAGCAATATCGCAGAATATCGCAGCGACTACAAGCCCCTACAAGCCCCTGACCTATGAGTACATCCCTGACCTATGAGTACATCTACTACCTGTTTGCTTGCTCTGGCTTTGGGGGTGTATTACTATACCCCCAGCTATCCCAGCTATGGGTACTACCCCAGTATACTACCCCAGTACCTTTGCCAGGTAGTACCTTTGCCAGGTCCTCGGCTG

Full Affymetrix probeset data:

Annotations for 1627160_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720