FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627162_at:

>probe:Drosophila_2:1627162_at:560:319; Interrogation_Position=211; Antisense; GCCGCTCATTGCCTTTCTAATGTAA
>probe:Drosophila_2:1627162_at:84:513; Interrogation_Position=238; Antisense; GTGACGGATCTATCAGTTCGCGCTG
>probe:Drosophila_2:1627162_at:377:719; Interrogation_Position=254; Antisense; TTCGCGCTGGATCTTCGTATTGGAG
>probe:Drosophila_2:1627162_at:323:235; Interrogation_Position=346; Antisense; AATCCGTATGATATTGCTGTGCTAA
>probe:Drosophila_2:1627162_at:252:129; Interrogation_Position=381; Antisense; ACCTCTCAGACTTGGTGGCACTGTA
>probe:Drosophila_2:1627162_at:138:387; Interrogation_Position=408; Antisense; GAAAATTCCTCTAGCCGAACAGACT
>probe:Drosophila_2:1627162_at:657:103; Interrogation_Position=428; Antisense; AGACTCCCGTGGCTGGTACAATTGT
>probe:Drosophila_2:1627162_at:2:491; Interrogation_Position=443; Antisense; GTACAATTGTTTTGACCTCCGGATG
>probe:Drosophila_2:1627162_at:617:423; Interrogation_Position=479; Antisense; GAGAGAACTCTTCATTCCTTTGGCC
>probe:Drosophila_2:1627162_at:291:401; Interrogation_Position=583; Antisense; GACATGATCTGTGCCGACGGACAAA
>probe:Drosophila_2:1627162_at:39:465; Interrogation_Position=628; Antisense; GATTCCGGTGGTCCTTTGATTGAAA
>probe:Drosophila_2:1627162_at:680:393; Interrogation_Position=657; Antisense; GAAAGGCGGCCATAGGCAACTCATA
>probe:Drosophila_2:1627162_at:181:467; Interrogation_Position=704; Antisense; GTTGTGGTACAAATCCTGGCGTCTA
>probe:Drosophila_2:1627162_at:536:457; Interrogation_Position=733; Antisense; GATATTGCATTCTTCCACAACTGGA

Paste this into a BLAST search page for me
GCCGCTCATTGCCTTTCTAATGTAAGTGACGGATCTATCAGTTCGCGCTGTTCGCGCTGGATCTTCGTATTGGAGAATCCGTATGATATTGCTGTGCTAAACCTCTCAGACTTGGTGGCACTGTAGAAAATTCCTCTAGCCGAACAGACTAGACTCCCGTGGCTGGTACAATTGTGTACAATTGTTTTGACCTCCGGATGGAGAGAACTCTTCATTCCTTTGGCCGACATGATCTGTGCCGACGGACAAAGATTCCGGTGGTCCTTTGATTGAAAGAAAGGCGGCCATAGGCAACTCATAGTTGTGGTACAAATCCTGGCGTCTAGATATTGCATTCTTCCACAACTGGA

Full Affymetrix probeset data:

Annotations for 1627162_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720