Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627164_at:

>probe:Drosophila_2:1627164_at:231:473; Interrogation_Position=2897; Antisense; GTTAATTCACGCGATCAGGACTTTC
>probe:Drosophila_2:1627164_at:423:557; Interrogation_Position=2914; Antisense; GGACTTTCGATCATCTTGAACCATG
>probe:Drosophila_2:1627164_at:234:381; Interrogation_Position=2931; Antisense; GAACCATGAGTAGGCAACGATCCAA
>probe:Drosophila_2:1627164_at:617:227; Interrogation_Position=2961; Antisense; AATGGCTACACCTGTGGGTTTTGAA
>probe:Drosophila_2:1627164_at:210:209; Interrogation_Position=3066; Antisense; AAGCTTTACCAAATCCGCCGATGAT
>probe:Drosophila_2:1627164_at:315:165; Interrogation_Position=3105; Antisense; AAATCACAGGGCCAATTGCGACGCA
>probe:Drosophila_2:1627164_at:549:363; Interrogation_Position=3165; Antisense; GAATTGCGCCTGTTATTAGATAGCC
>probe:Drosophila_2:1627164_at:365:703; Interrogation_Position=3180; Antisense; TTAGATAGCCAATGACCAGTTTTTT
>probe:Drosophila_2:1627164_at:674:607; Interrogation_Position=3258; Antisense; TGAATACTTACCACCCAAACAGAGC
>probe:Drosophila_2:1627164_at:665:517; Interrogation_Position=3351; Antisense; GTGGAAGTGTAGCTGACCTCAAACG
>probe:Drosophila_2:1627164_at:236:131; Interrogation_Position=3366; Antisense; ACCTCAAACGTTCCCATATCATGAT
>probe:Drosophila_2:1627164_at:310:23; Interrogation_Position=3381; Antisense; ATATCATGATCAATCCACCAGTCCT
>probe:Drosophila_2:1627164_at:648:233; Interrogation_Position=3392; Antisense; AATCCACCAGTCCTCATAATAGGCT
>probe:Drosophila_2:1627164_at:420:25; Interrogation_Position=3410; Antisense; ATAGGCTAGATCTGTGCGACACTTT

Paste this into a BLAST search page for me
GTTAATTCACGCGATCAGGACTTTCGGACTTTCGATCATCTTGAACCATGGAACCATGAGTAGGCAACGATCCAAAATGGCTACACCTGTGGGTTTTGAAAAGCTTTACCAAATCCGCCGATGATAAATCACAGGGCCAATTGCGACGCAGAATTGCGCCTGTTATTAGATAGCCTTAGATAGCCAATGACCAGTTTTTTTGAATACTTACCACCCAAACAGAGCGTGGAAGTGTAGCTGACCTCAAACGACCTCAAACGTTCCCATATCATGATATATCATGATCAATCCACCAGTCCTAATCCACCAGTCCTCATAATAGGCTATAGGCTAGATCTGTGCGACACTTT

Full Affymetrix probeset data:

Annotations for 1627164_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime