Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627165_a_at:

>probe:Drosophila_2:1627165_a_at:103:521; Interrogation_Position=649; Antisense; GTGGCTAACCATGGTTTGGTAGTTA
>probe:Drosophila_2:1627165_a_at:372:723; Interrogation_Position=664; Antisense; TTGGTAGTTATCACCCGGGCCGGCT
>probe:Drosophila_2:1627165_a_at:637:569; Interrogation_Position=685; Antisense; GGCTCAAACCCAGGAAAATTCATCT
>probe:Drosophila_2:1627165_a_at:45:39; Interrogation_Position=706; Antisense; ATCTTTGACTCCGACATATTGACCA
>probe:Drosophila_2:1627165_a_at:380:691; Interrogation_Position=722; Antisense; TATTGACCAAGTATCAGAGCAACAT
>probe:Drosophila_2:1627165_a_at:593:101; Interrogation_Position=737; Antisense; AGAGCAACATTACGCTAATCACCAA
>probe:Drosophila_2:1627165_a_at:360:339; Interrogation_Position=750; Antisense; GCTAATCACCAACTGGGTGCCTAAT
>probe:Drosophila_2:1627165_a_at:306:627; Interrogation_Position=767; Antisense; TGCCTAATGAGGTGAGCTCCACGTT
>probe:Drosophila_2:1627165_a_at:674:511; Interrogation_Position=778; Antisense; GTGAGCTCCACGTTGATTCGGCGGC
>probe:Drosophila_2:1627165_a_at:550:7; Interrogation_Position=793; Antisense; ATTCGGCGGCTCTTAGGACGCGGCC
>probe:Drosophila_2:1627165_a_at:436:679; Interrogation_Position=806; Antisense; TAGGACGCGGCCAGTCGGTCAAGTA
>probe:Drosophila_2:1627165_a_at:424:499; Interrogation_Position=819; Antisense; GTCGGTCAAGTACCTTCTAGACGAT
>probe:Drosophila_2:1627165_a_at:69:277; Interrogation_Position=832; Antisense; CTTCTAGACGATCTGGTGCTGGAGT
>probe:Drosophila_2:1627165_a_at:209:551; Interrogation_Position=852; Antisense; GGAGTACATCAAGCGCCAACGATTG

Paste this into a BLAST search page for me
GTGGCTAACCATGGTTTGGTAGTTATTGGTAGTTATCACCCGGGCCGGCTGGCTCAAACCCAGGAAAATTCATCTATCTTTGACTCCGACATATTGACCATATTGACCAAGTATCAGAGCAACATAGAGCAACATTACGCTAATCACCAAGCTAATCACCAACTGGGTGCCTAATTGCCTAATGAGGTGAGCTCCACGTTGTGAGCTCCACGTTGATTCGGCGGCATTCGGCGGCTCTTAGGACGCGGCCTAGGACGCGGCCAGTCGGTCAAGTAGTCGGTCAAGTACCTTCTAGACGATCTTCTAGACGATCTGGTGCTGGAGTGGAGTACATCAAGCGCCAACGATTG

Full Affymetrix probeset data:

Annotations for 1627165_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime