FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627166_at:

>probe:Drosophila_2:1627166_at:610:627; Interrogation_Position=442; Antisense; TGCCACATGTGCGTCCTGAAAATGG
>probe:Drosophila_2:1627166_at:231:415; Interrogation_Position=466; Antisense; GACCACCACTGTCCTTGGATAGTGA
>probe:Drosophila_2:1627166_at:323:613; Interrogation_Position=488; Antisense; TGAACTGCGTGCACTTTCACAACTT
>probe:Drosophila_2:1627166_at:221:75; Interrogation_Position=515; Antisense; AGTACTTCATACTCTTCCTGTTTTA
>probe:Drosophila_2:1627166_at:153:685; Interrogation_Position=559; Antisense; TATCTGTTCTGCGTAATGGTCTATG
>probe:Drosophila_2:1627166_at:529:583; Interrogation_Position=600; Antisense; TGGCTTTGAAGTTACTGCCCTGAAA
>probe:Drosophila_2:1627166_at:215:165; Interrogation_Position=723; Antisense; AAATCGCACCACTATGGAGTCGGCT
>probe:Drosophila_2:1627166_at:648:549; Interrogation_Position=738; Antisense; GGAGTCGGCTTATGCCACATACTTT
>probe:Drosophila_2:1627166_at:269:151; Interrogation_Position=754; Antisense; ACATACTTTCTTCTTGGCGGCAAGA
>probe:Drosophila_2:1627166_at:298:453; Interrogation_Position=832; Antisense; GATAAGTGGTACCTCTGGCCCTTTC
>probe:Drosophila_2:1627166_at:719:451; Interrogation_Position=858; Antisense; GATCTTCTCTAGTCGTGGTGACGGA
>probe:Drosophila_2:1627166_at:506:589; Interrogation_Position=873; Antisense; TGGTGACGGATTTTCATTCCCCTTG
>probe:Drosophila_2:1627166_at:11:273; Interrogation_Position=894; Antisense; CTTGGCCCACGATCGACTAAAGGAA
>probe:Drosophila_2:1627166_at:170:247; Interrogation_Position=990; Antisense; AATTCTCGGAATTCATCAGCCACCT

Paste this into a BLAST search page for me
TGCCACATGTGCGTCCTGAAAATGGGACCACCACTGTCCTTGGATAGTGATGAACTGCGTGCACTTTCACAACTTAGTACTTCATACTCTTCCTGTTTTATATCTGTTCTGCGTAATGGTCTATGTGGCTTTGAAGTTACTGCCCTGAAAAAATCGCACCACTATGGAGTCGGCTGGAGTCGGCTTATGCCACATACTTTACATACTTTCTTCTTGGCGGCAAGAGATAAGTGGTACCTCTGGCCCTTTCGATCTTCTCTAGTCGTGGTGACGGATGGTGACGGATTTTCATTCCCCTTGCTTGGCCCACGATCGACTAAAGGAAAATTCTCGGAATTCATCAGCCACCT

Full Affymetrix probeset data:

Annotations for 1627166_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720